Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 39

1.

rs17487514 [Homo sapiens]
    TGAGCAACAGAGTGACCGGTTGGTG[C/T]GACTCATAAACAGCCTCTTCAGTAC
    Chromosome:
    15:78661443
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1060/531
    HGVS:
    NC_000015.10:g.78661443C>T, NC_000015.9:g.78953785C>T, NG_011096.1:g.299G>A
    3.

    rs17486278 [Homo sapiens]
      AGCAAGGTTACATTTCTTTGAAAAT[A/C]AATGTGGTTTCACCAAATGATTTGA
      Chromosome:
      15:78575140
      Gene:
      CHRNA5 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2788/1396
      HGVS:
      NC_000015.10:g.78575140A>C, NC_000015.9:g.78867482A>C, NG_023328.1:g.14621A>C, NM_000745.3:c.107-5671A>C, NM_001307945.1:c.107-5671A>C, XM_005254142.1:c.107-5671A>C, XM_005254142.3:c.107-5671A>C, XM_017021881.1:c.107-5671A>C, XR_001751067.1:n.306-5671A>C
      4.

      rs16969968 [Homo sapiens]
        TAGAAACACATTGGAAGCTGCGCTC[A/G]ATTCTATTCGCTACATTACAAGACA
        Chromosome:
        15:78590583
        Gene:
        CHRNA5 (GeneView)
        Functional Consequence:
        intron variant,missense,nc transcript variant
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1496/749
        HGVS:
        NC_000015.10:g.78590583G>A, NC_000015.9:g.78882925G>A, NG_023328.1:g.30064G>A, NM_000745.3:c.1192G>A, NM_001307945.1:c.458+734G>A, NP_000736.2:p.Asp398Asn, XM_005254142.1:c.707+485G>A, XM_005254142.3:c.707+485G>A, XM_017021881.1:c.713+479G>A, XR_001751067.1:n.1391G>A
        5.

        rs12910984 [Homo sapiens]
          AGCCACTGTGCCTGGCTTATATCTA[A/G]CTCCTAAAGTCTTTAAAGCACAATG
          Chromosome:
          15:78599285
          Gene:
          CHRNA3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4113/2060
          HGVS:
          NC_000015.10:g.78599285G>A, NC_000015.9:g.78891627G>A, NG_016143.1:g.27011C>T, NM_000743.4:c.1389+1968C>T, NM_001166694.1:c.1389+1968C>T, NR_046313.1:n.1890+1968C>T, XM_006720382.2:c.1188+1968C>T
          6.

          rs11637630 [Homo sapiens]
            TGTCCATGAATACTCTGAGGATTCT[A/G]TCAGCAAATGAACTTTAGAAAACAA
            Chromosome:
            15:78607377
            Gene:
            CHRNA3 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4010/2008
            HGVS:
            NC_000015.10:g.78607377G>A, NC_000015.9:g.78899719G>A, NG_016143.1:g.18919C>T, NM_000743.4:c.378-5113C>T, NM_001166694.1:c.378-5113C>T, NR_046313.1:n.879-5113C>T, XM_006720382.2:c.177-5113C>T
            7.

            rs11636605 [Homo sapiens]
              CTCTACCTCTACCCCAGATACTCAG[A/G]TACTCTCTCTTCTGGCCATAGCCTA
              Chromosome:
              15:78636536
              Gene:
              CHRNB4 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4451/2229
              HGVS:
              NC_000015.10:g.78636536A>G, NC_000015.9:g.78928878A>G, NM_000750.3:c.56-949T>C, NM_001256567.1:c.56-949T>C, XM_011521186.2:c.47-949T>C, XM_011521187.2:c.47-949T>C, XM_011521190.2:c.-1933T>C, XM_011521191.2:c.-19+4543T>C, XM_011521192.2:c.-639-949T>C, XM_017021885.1:c.-36+401T>C, XM_017021886.1:c.-36+729T>C, XM_017021887.1:c.56-949T>C, XM_017021888.1:c.56-949T>C, XM_017021889.1:c.56-949T>C
              8.

              rs9920506 [Homo sapiens]
                CCCACTTGCCCCCCAAAAAGGGGCG[A/G]CGGAGCCCAGCCCAGCCCAGCACAT
                Chromosome:
                15:78638715
                Gene:
                CHRNB4 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB,utr variant 5 prime
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3319/1662
                HGVS:
                NC_000015.10:g.78638715A>G, NC_000015.9:g.78931057A>G, NM_000750.3:c.55+2364T>C, NM_001256567.1:c.55+2364T>C, XM_011521186.2:c.47-3128T>C, XM_011521187.2:c.47-3128T>C, XM_011521191.2:c.-19+2364T>C, XM_011521192.2:c.-640+2364T>C, XM_017021885.1:c.-1814T>C, XM_017021886.1:c.-1486T>C, XM_017021887.1:c.55+2364T>C, XM_017021888.1:c.55+2364T>C, XM_017021889.1:c.55+2364T>C
                9.

                rs8042374 [Homo sapiens]
                  TAACGTAATACATATTAACTTTAGA[A/G]AAGACAGTGAGGAACAAAGAATAAA
                  Chromosome:
                  15:78615690
                  Gene:
                  CHRNA3 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4495/2251
                  HGVS:
                  NC_000015.10:g.78615690A>G, NC_000015.9:g.78908032A>G, NG_016143.1:g.10606T>C, NM_000743.4:c.377+1334T>C, NM_001166694.1:c.377+1334T>C, NR_046313.1:n.878+1334T>C, XM_006720382.2:c.176+1334T>C
                  10.

                  rs8042059 [Homo sapiens]
                    GTCCTCATCTGTGAAATGTCAGGGA[A/C]GGGCCAGATCAGGGATCCCCAAAGC
                    Chromosome:
                    15:78615517
                    Gene:
                    CHRNA3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.4495/2251
                    HGVS:
                    NC_000015.10:g.78615517A>C, NC_000015.9:g.78907859A>C, NG_016143.1:g.10779T>G, NM_000743.4:c.377+1507T>G, NM_001166694.1:c.377+1507T>G, NR_046313.1:n.878+1507T>G, XM_006720382.2:c.176+1507T>G
                    11.

                    rs7177514 [Homo sapiens]
                      GGACTGGCTCGAGAGCAGCTTCTCT[C/G]GATGGCAGGAGCCAGGGAAGTCTTT
                      Chromosome:
                      15:78615064
                      Gene:
                      CHRNA3 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4495/2251
                      HGVS:
                      NC_000015.10:g.78615064C>G, NC_000015.9:g.78907406C>G, NG_016143.1:g.11232G>C, NM_000743.4:c.377+1960G>C, NM_001166694.1:c.377+1960G>C, NR_046313.1:n.878+1960G>C, XM_006720382.2:c.176+1960G>C
                      12.

                      rs7164030 [Homo sapiens]
                        TAAGTAGAAAACCAAAGACAGCTAA[A/G]TTTTAAATCTTGAGTCAAAACTTTA
                        Chromosome:
                        15:78552319
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2472/1238
                        HGVS:
                        NC_000015.10:g.78552319G>A, NC_000015.9:g.78844661G>A
                        13.

                        rs6495308 [Homo sapiens]
                          TAACTGTCTGATGGCAGGTTTGCTG[C/T]TGGGAGAGTAGAGAAGAGGTTTGGG
                          Chromosome:
                          15:78615314
                          Gene:
                          CHRNA3 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.4495/2251
                          HGVS:
                          NC_000015.10:g.78615314T>C, NC_000015.9:g.78907656T>C, NG_016143.1:g.10982A>G, NM_000743.4:c.377+1710A>G, NM_001166694.1:c.377+1710A>G, NR_046313.1:n.878+1710A>G, XM_006720382.2:c.176+1710A>G
                          14.

                          rs6495307 [Homo sapiens]
                            ATGCCATATTTGCCATGAGGTACTT[C/T]ATTTGAATTCCTAAGACTGGTTTGT
                            Chromosome:
                            15:78597979
                            Gene:
                            CHRNA3 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.3099/1552
                            HGVS:
                            NC_000015.10:g.78597979C>T, NC_000015.9:g.78890321C>T, NG_016143.1:g.28317G>A, NM_000743.4:c.1390-1247G>A, NM_001166694.1:c.1389+3274G>A, NR_046313.1:n.1891-1247G>A, XM_006720382.2:c.1189-1247G>A
                            15.

                            Error occurred: cannot get document summary

                            16.

                            rs3813567 [Homo sapiens]
                              CACTTCAACAGTGTTGTTGTTGTTG[C/T]TTTTAAAGACCATATGTCAACATGT
                              Chromosome:
                              15:78642209
                              Gene:
                              CHRNB4 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.3385/1695
                              HGVS:
                              NC_000015.10:g.78642209G>A, NC_000015.9:g.78934551G>A, NM_000750.3:c.-1076C>T, NM_001256567.1:c.-1076C>T, XM_011521186.2:c.47-6622C>T, XM_011521187.2:c.47-6622C>T, XM_011521191.2:c.-1149C>T, XM_011521192.2:c.-1770C>T, XM_017021887.1:c.-1076C>T, XM_017021888.1:c.-1076C>T, XM_017021889.1:c.-1076C>T
                              17.

                              rs3743078 [Homo sapiens]
                                CCTCAGTATCCCTGTTGGTAAATGG[C/G]GCCAGGAAATGGGTGACCTTTTATG
                                Chromosome:
                                15:78602417
                                Gene:
                                CHRNA3 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.4449/2228
                                HGVS:
                                NC_000015.10:g.78602417C>G, NC_000015.9:g.78894759C>G, NG_016143.1:g.23879G>C, NM_000743.4:c.378-153G>C, NM_001166694.1:c.378-153G>C, NR_046313.1:n.879-153G>C, XM_006720382.2:c.177-153G>C
                                18.

                                rs3743077 [Homo sapiens]
                                  AATTAAAGGGGGACCAATCCTCTTC[A/G]GGCATTTGGGAGTCTATCAGTTTGG
                                  Chromosome:
                                  15:78602554
                                  Gene:
                                  CHRNA3 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.2330/1167
                                  HGVS:
                                  NC_000015.10:g.78602554C>T, NC_000015.9:g.78894896C>T, NG_016143.1:g.23742G>A, NM_000743.4:c.378-290G>A, NM_001166694.1:c.378-290G>A, NR_046313.1:n.879-290G>A, XM_006720382.2:c.177-290G>A
                                  19.

                                  rs3743075 [Homo sapiens]
                                    AGATCTGGAATGACTACAAGCTGAA[A/G]TGGAACCCCTCTGACTATGGTGGGG
                                    Chromosome:
                                    15:78617110
                                    Gene:
                                    CHRNA3 (GeneView)
                                    Functional Consequence:
                                    nc transcript variant,synonymous codon
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.3650/1828
                                    HGVS:
                                    NC_000015.10:g.78617110T>C, NC_000015.9:g.78909452T>C, NG_016143.1:g.9186A>G, NM_000743.4:c.291A>G, NM_001166694.1:c.291A>G, NP_000734.2:p.Lys97, NP_001160166.1:p.Lys97, NR_046313.1:n.792A>G, XM_006720382.2:c.90A>G, XP_006720445.1:p.Lys30
                                    20.

                                    rs3743073 [Homo sapiens]
                                      GGAGTCACCAAGATGGGTGGTGCCA[A/C]GGGAAGTAAAACCAGGCTGATTCTT
                                      Chromosome:
                                      15:78617197
                                      Gene:
                                      CHRNA3 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      G=0.3810/1908
                                      HGVS:
                                      NC_000015.10:g.78617197G>T, NC_000015.9:g.78909539G>T, NG_016143.1:g.9099C>A, NM_000743.4:c.268-64C>A, NM_001166694.1:c.268-64C>A, NR_046313.1:n.769-64C>A, XM_006720382.2:c.67-64C>A

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center