Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

2.

rs17327442 [Homo sapiens]
    GCTAGTCTTCACAACTAGATCATCA[A/T]CTGTTTGGGAGCTCATGCATGCTAT
    Chromosome:
    7:87583674
    Gene:
    ABCB1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.1853/928
    HGVS:
    CM000669.2:g.87583674T>A, NC_000007.13:g.87212990T>A, NC_000007.14:g.87583674T>A, NG_011513.1:g.134575A>T, NM_000927.4:c.286+1838A>T, NM_001348944.1:c.286+1838A>T, NM_001348945.1:c.496+1838A>T, NM_001348946.1:c.286+1838A>T
    3.

    rs4148733 [Homo sapiens]
      TGGCGTTAGCTCTCTTACTGCTTCA[C/T]AGTGGAAGAATCAAATACTTCATCA
      Chromosome:
      7:87583916
      Gene:
      ABCB1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.1681/842
      HGVS:
      CM000669.2:g.87583916A>G, NC_000007.13:g.87213232A>G, NC_000007.14:g.87583916A>G, NG_011513.1:g.134333T>C, NM_000927.4:c.286+1596T>C, NM_001348944.1:c.286+1596T>C, NM_001348945.1:c.496+1596T>C, NM_001348946.1:c.286+1596T>C
      5.

      rs1045642 [Homo sapiens]
        GCCGGGTGGTGTCACAGGAAGAGAT[A/C/T]GTGAGGGCAGCAAAGGAGGCCAACA
        Chromosome:
        7:87509329
        Gene:
        ABCB1 (GeneView)
        Functional Consequence:
        synonymous codon
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
        Global MAF:
        A=0.3952/1979
        HGVS:
        CM000669.2:g.87509329A>G, NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NM_001348944.1:c.3435T>C, NM_001348945.1:c.3645T>C, NM_001348946.1:c.3435T>C, NP_000918.2:p.Ile1145, NP_001335873.1:p.Ile1145, NP_001335874.1:p.Ile1215, NP_001335875.1:p.Ile1145

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center