Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

1.
2.

rs10811661 [Homo sapiens]
    CAGCTCACCTCCAGCTTTAGTTTTC[C/T]CATGACAGTAAGTCTATTACCCTCC
    Chromosome:
    9:22134095
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1763/883
    HGVS:
    NC_000009.11:g.22134094T>C, NC_000009.12:g.22134095T>C
    3.

    rs10757278 [Homo sapiens]
      AAGTCAGGGTGTGGTCATTCCGGTA[A/G]GCAGCGATGCAGAATCAAGACAGAG
      Chromosome:
      9:22124478
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4081/2044
      HGVS:
      NC_000009.11:g.22124477A>G, NC_000009.12:g.22124478A>G
      4.
      5.
      6.
      7.

      rs7923837 [Homo sapiens]
        GGCAAGAAACTTTGTGGCACTGGTT[A/G]TTTACCATTTTAAAACGTAAAAAAA
        Chromosome:
        10:92722160
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4289/2148
        HGVS:
        NC_000010.10:g.94481917G>A, NC_000010.11:g.92722160G>A
        8.

        rs7903146 [Homo sapiens]
          TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG
          Chromosome:
          10:112998590
          Gene:
          TCF7L2 (GeneView)
          Functional Consequence:
          intron variant
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2278/1141
          HGVS:
          NC_000010.10:g.114758349C>T, NC_000010.11:g.112998590C>T, NG_012631.1:g.53341C>T, NM_001146274.1:c.450+33966C>T, NM_001146283.1:c.382-41435C>T, NM_001146284.1:c.382-41435C>T, NM_001146285.1:c.382-41435C>T, NM_001146286.1:c.382-41435C>T, NM_001198525.1:c.382-41435C>T, NM_001198526.1:c.382-41435C>T, NM_001198527.1:c.382-41435C>T, NM_001198528.1:c.382-41435C>T, NM_001198529.1:c.382-41435C>T, NM_001198530.1:c.381+46983C>T, NM_001198531.1:c.450+33966C>T, NM_030756.4:c.382-41435C>T, XM_005270071.1:c.450+33966C>T, XM_005270072.1:c.450+33966C>T, XM_005270073.1:c.450+33966C>T, XM_005270074.1:c.450+33966C>T, XM_005270075.1:c.450+33966C>T, XM_005270076.1:c.450+33966C>T, XM_005270077.1:c.450+33966C>T, XM_005270078.1:c.450+33966C>T, XM_005270079.1:c.450+33966C>T, XM_005270080.1:c.382-41435C>T, XM_005270081.1:c.382-41435C>T, XM_005270082.1:c.450+33966C>T, XM_005270083.1:c.450+33966C>T, XM_005270084.1:c.450+33966C>T, XM_005270085.1:c.450+33966C>T, XM_005270086.1:c.382-41435C>T, XM_005270087.1:c.382-41435C>T, XM_005270088.1:c.382-41435C>T, XM_005270089.1:c.382-41435C>T, XM_005270090.1:c.381+46983C>T, XM_005270091.1:c.450+33966C>T, XM_005270091.2:c.450+33966C>T, XM_005270092.1:c.450+33966C>T, XM_005270093.1:c.450+33966C>T, XM_005270093.2:c.450+33966C>T, XM_005270094.1:c.450+33966C>T, XM_005270094.2:c.450+33966C>T, XM_005270095.1:c.450+33966C>T, XM_005270096.1:c.450+33966C>T, XM_005270096.2:c.450+33966C>T, XM_005270100.1:c.450+33966C>T, XM_005270101.1:c.382-41435C>T, XM_005270101.2:c.382-41435C>T, XM_005270102.1:c.450+33966C>T, XM_005270103.1:c.382-41435C>T, XM_005270104.1:c.382-41435C>T, XM_011540109.1:c.450+33966C>T, XM_011540110.1:c.382-41435C>T, XM_011540111.1:c.382-41435C>T, XM_011540113.2:c.450+33966C>T, XM_011540116.1:c.450+33966C>T, XM_017016584.1:c.450+33966C>T, XM_017016585.1:c.450+33966C>T, XM_017016586.1:c.450+33966C>T, XM_017016587.1:c.450+33966C>T, XM_017016588.1:c.382-41435C>T, XM_017016589.1:c.450+33966C>T, XM_017016590.1:c.450+33966C>T, XM_017016591.1:c.450+33966C>T, XM_017016592.1:c.450+33966C>T, XM_017016593.1:c.450+33966C>T, XM_017016594.1:c.382-41435C>T, XM_017016595.1:c.450+33966C>T, XM_017016596.1:c.450+33966C>T
          9.

          rs7901695 [Homo sapiens]
            catataaatggtatcataaaatcta[C/T]gggcttttgtgtctgtctgctttca
            Chromosome:
            10:112994329
            Gene:
            TCF7L2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.2821/1413
            HGVS:
            NC_000010.10:g.114754088T>C, NC_000010.11:g.112994329T>C, NG_012631.1:g.49080T>C, NM_001146274.1:c.450+29705T>C, NM_001146283.1:c.381+42722T>C, NM_001146284.1:c.381+42722T>C, NM_001146285.1:c.381+42722T>C, NM_001146286.1:c.381+42722T>C, NM_001198525.1:c.381+42722T>C, NM_001198526.1:c.381+42722T>C, NM_001198527.1:c.381+42722T>C, NM_001198528.1:c.381+42722T>C, NM_001198529.1:c.381+42722T>C, NM_001198530.1:c.381+42722T>C, NM_001198531.1:c.450+29705T>C, NM_030756.4:c.381+42722T>C, XM_005270071.1:c.450+29705T>C, XM_005270072.1:c.450+29705T>C, XM_005270073.1:c.450+29705T>C, XM_005270074.1:c.450+29705T>C, XM_005270075.1:c.450+29705T>C, XM_005270076.1:c.450+29705T>C, XM_005270077.1:c.450+29705T>C, XM_005270078.1:c.450+29705T>C, XM_005270079.1:c.450+29705T>C, XM_005270080.1:c.381+42722T>C, XM_005270081.1:c.381+42722T>C, XM_005270082.1:c.450+29705T>C, XM_005270083.1:c.450+29705T>C, XM_005270084.1:c.450+29705T>C, XM_005270085.1:c.450+29705T>C, XM_005270086.1:c.381+42722T>C, XM_005270087.1:c.381+42722T>C, XM_005270088.1:c.381+42722T>C, XM_005270089.1:c.381+42722T>C, XM_005270090.1:c.381+42722T>C, XM_005270091.1:c.450+29705T>C, XM_005270091.2:c.450+29705T>C, XM_005270092.1:c.450+29705T>C, XM_005270093.1:c.450+29705T>C, XM_005270093.2:c.450+29705T>C, XM_005270094.1:c.450+29705T>C, XM_005270094.2:c.450+29705T>C, XM_005270095.1:c.450+29705T>C, XM_005270096.1:c.450+29705T>C, XM_005270096.2:c.450+29705T>C, XM_005270100.1:c.450+29705T>C, XM_005270101.1:c.381+42722T>C, XM_005270101.2:c.381+42722T>C, XM_005270102.1:c.450+29705T>C, XM_005270103.1:c.381+42722T>C, XM_005270104.1:c.381+42722T>C, XM_011540109.1:c.450+29705T>C, XM_011540110.1:c.381+42722T>C, XM_011540111.1:c.381+42722T>C, XM_011540113.2:c.450+29705T>C, XM_011540116.1:c.450+29705T>C, XM_017016584.1:c.450+29705T>C, XM_017016585.1:c.450+29705T>C, XM_017016586.1:c.450+29705T>C, XM_017016587.1:c.450+29705T>C, XM_017016588.1:c.381+42722T>C, XM_017016589.1:c.450+29705T>C, XM_017016590.1:c.450+29705T>C, XM_017016591.1:c.450+29705T>C, XM_017016592.1:c.450+29705T>C, XM_017016593.1:c.450+29705T>C, XM_017016594.1:c.381+42722T>C, XM_017016595.1:c.450+29705T>C, XM_017016596.1:c.450+29705T>C
            12.

            rs5015480 [Homo sapiens]
              GAAGTAAACTCGAATGTTGATTATA[C/T]GTTTTCTATCAAATTATTCAAGTAT
              Chromosome:
              10:92705802
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4549/2278
              HGVS:
              NC_000010.10:g.94465559C>T, NC_000010.11:g.92705802C>T
              14.

              rs3802177 [Homo sapiens]
                AGATAAAATGTGCATTGCACCATGA[C/T]ATGAATTTCTTCCTTTGGTTCCTTA
                Chromosome:
                8:117172786
                Gene:
                LOC105375716 (GeneView) SLC30A8 (GeneView)
                Functional Consequence:
                intron variant,utr variant 3 prime
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2562/1283
                HGVS:
                NC_000008.10:g.118185025G>A, NC_000008.11:g.117172786G>A, NG_016991.1:g.227514G>A, NM_001172811.1:c.*105G>A, NM_001172813.1:c.*105G>A, NM_001172814.1:c.*105G>A, NM_001172815.2:c.*105G>A, NM_173851.2:c.*105G>A, XM_005250809.1:c.*105G>A, XR_928569.2:n.843-41C>T, XR_928570.2:n.843-41C>T
                15.

                rs1333040 [Homo sapiens]
                  GACAGGAGGGTCAGAGGTAAGAATG[C/T]TACCGCTGGGACAGAGAGGAAGGTA
                  Chromosome:
                  9:22083405
                  Gene:
                  CDKN2B-AS1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.3838/1922
                  HGVS:
                  NC_000009.11:g.22083404C>T, NC_000009.12:g.22083405C>T, NR_003529.3:n.2449-12967C>T, NR_047532.1:n.1076-8903C>T, NR_047534.1:n.645-13853C>T, NR_047535.1:n.780+27018C>T, NR_047536.1:n.645-28915C>T, NR_047537.1:n.780+27018C>T, NR_047538.1:n.644+34177C>T, NR_047543.1:n.780+27018C>T, NR_120536.1:n.644+34177C>T
                  16.

                  rs1111875 [Homo sapiens]
                    TCCGTACCATCAAGTCATTTCCTCT[A/G]GACGTCTGAACCTGCACTCAGGGTC
                    Chromosome:
                    10:92703125
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    T=0.4563/2285
                    HGVS:
                    NC_000010.10:g.94462882C>T, NC_000010.11:g.92703125C>T
                    17.

                    rs564398 [Homo sapiens]
                      TGGCACATACCACACCCTAACTACC[A/G]CAAAGAAAGTCATGGGGGCCAGGAC
                      Chromosome:
                      9:22029548
                      Gene:
                      CDKN2B-AS1 (GeneView)
                      Functional Consequence:
                      intron variant,nc transcript variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      C=0.1849/926
                      HGVS:
                      NC_000009.11:g.22029547T>C, NC_000009.12:g.22029548T>C, NR_003529.3:n.487T>C, NR_047532.1:n.487T>C, NR_047533.1:n.372-17203T>C, NR_047534.1:n.372-17203T>C, NR_047535.1:n.372-17203T>C, NR_047536.1:n.372-17203T>C, NR_047537.1:n.372-17203T>C, NR_047538.1:n.372-17203T>C, NR_047539.1:n.487T>C, NR_047540.1:n.372-17203T>C, NR_047541.1:n.372-17203T>C, NR_047542.1:n.372-17203T>C, NR_047543.1:n.372-17203T>C, NR_120536.1:n.372-17203T>C

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center