Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 10

1.

rs17782313 [Homo sapiens]
    GTTTAAAGCAGGAGAGATTGTATCC[C/T]GATGGAAATGACAAGAAAAGCTTCA
    Chromosome:
    18:60183864
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2400/1202
    HGVS:
    NC_000018.10:g.60183864T>C, NC_000018.9:g.57851097T>C
    2.

    rs17700633 [Homo sapiens]
      GTTTCACTGTGTGGCAAGACAGAAT[A/G]TTGTGGTACCCGGTCGCTGCTAAGG
      Chromosome:
      18:60262199
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2434/1219
      HGVS:
      NC_000018.10:g.60262199G>A, NC_000018.9:g.57929432G>A
      3.

      rs12955983 [Homo sapiens]
        TCTTAGGGGTTGTTTTAGAAAACTG[A/G]GCTGGAACCAATGGTTTACAGTTAT
        Chromosome:
        18:60205756
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1971/987
        HGVS:
        NC_000018.10:g.60205756A>G, NC_000018.9:g.57872989A>G
        4.

        rs10498767 [Homo sapiens]
          ATTTACCTGTCAAATTTAATACCAA[C/G]ATATGAGACCTGGCCACTACGTACC
          Chromosome:
          6:46395820
          Gene:
          RCAN2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4926/2467
          HGVS:
          NC_000006.11:g.46363557C>G, NC_000006.12:g.46395820C>G, NG_030437.1:g.101248G>C, NM_001251973.1:c.225+60932G>C, NM_001251974.1:c.225+60932G>C, XM_005248782.1:c.282+60932G>C, XM_011514226.1:c.225+60932G>C
          5.

          rs9956279 [Homo sapiens]
            tacaagtgtgagtcaccatgcccga[C/T]cTCTATATTCTCTTTTATTTCCATT
            Chromosome:
            18:60275566
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1771/887
            HGVS:
            NC_000018.10:g.60275566C>T, NC_000018.9:g.57942799C>T
            6.
            7.

            rs2229616 [Homo sapiens]
              CGTTTCAAATGGATCAGAAACCATT[A/G]TCATCACCCTATTAAACAGTACAGA
              Chromosome:
              18:60372043
              Gene:
              MC4R (GeneView)
              Functional Consequence:
              missense
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.0162/81
              HGVS:
              NC_000018.10:g.60372043C>T, NC_000018.9:g.58039276C>T, NG_016441.1:g.5726G>A, NM_005912.2:c.307G>A, NP_005903.2:p.Val103Ile
              8.
              9.

              rs748192 [Homo sapiens]
                AGCAGGGAGGAATCTGTGCCCTTTT[A/T]AAAACTGAGCATTGTGTATATATGC
                Chromosome:
                3:5847593
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1400/701
                HGVS:
                NC_000003.11:g.5889280T>A, NC_000003.12:g.5847593T>A
                10.

                rs718475 [Homo sapiens]
                  ggagggaagggctgaaaaactaaca[C/T]attggatactaaaatcactacaatg
                  Chromosome:
                  18:60270226
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.1707/855
                  HGVS:
                  NC_000018.10:g.60270226A>G, NC_000018.9:g.57937459A>G

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center