Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 57

1.

rs13013484 [Homo sapiens]
    CACAAGTCCCAGATCAGAAACTGAG[A/G]CGGGGGCTTGCTCAGTGTCGCGTGG
    Chromosome:
    2:27765954
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4814/2411
    HGVS:
    NC_000002.11:g.27988821G>A, NC_000002.12:g.27765954G>A
    2.

    rs12753193 [Homo sapiens]
      GATGGCTGGGTCACTGGCCACCTGC[A/G]GTTGTCTTCTTTCTCTTCTCATTAC
      Chromosome:
      1:65703996
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4740/2374
      HGVS:
      NC_000001.10:g.66169679G>A, NC_000001.11:g.65703996G>A
      4.

      rs12744244 [Homo sapiens]
        acttacagacacaagcatccaattt[A/C]ttcattatatcatctgctgaaggca
        Chromosome:
        1:159677866
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0759/380
        HGVS:
        NC_000001.10:g.159647656C>A, NC_000001.11:g.159677866C>A
        5.

        rs12409877 [Homo sapiens]
          AAGAGGAAGACCAAGTTTAGTGGAA[A/G]AACACCCAGGCTAGGATTTGGGAGA
          Chromosome:
          1:65478189
          Gene:
          LEPR (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4305/2156
          HGVS:
          NC_000001.10:g.65943872A>G, NC_000001.11:g.65478189A>G, NG_015831.2:g.62625A>G, NM_001003679.3:c.-21+52811A>G, NM_001003680.3:c.-21+52811A>G, NM_002303.5:c.-21+52811A>G, XM_005270952.1:c.-21+52811A>G
          6.

          rs12093699 [Homo sapiens]
            GTTTTTCATTCTAATATGGAGCAGA[A/C/G]TGTGCTCTCTAGATGGTTATCTAGT
            Chromosome:
            1:159678198
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2482/1243
            HGVS:
            NC_000001.10:g.159647988G>A, NC_000001.11:g.159678198G>A, NC_000001.11:g.159678198G>C
            7.

            rs12068753 [Homo sapiens]
              TCCACACCTTTCAGTTGCAGCTAAA[A/T]GACTCAGCAAGCTTAGAAAGGATGA
              Chromosome:
              1:159722747
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.1743/873
              HGVS:
              NC_000001.10:g.159692537T>A, NC_000001.11:g.159722747T>A
              8.

              rs12022410 [Homo sapiens]
                CCCTCAGGAGATGCTTGGCTCCTGA[A/G]GTCCCTGAAGTTGGAGCACATTTAG
                Chromosome:
                1:65688250
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3718/1862
                HGVS:
                NC_000001.10:g.66153933A>G, NC_000001.11:g.65688250A>G
                9.

                rs11265260 [Homo sapiens]
                  GTTTTCTAATACAGATACATTCCAC[A/G]CAAATTTGATTTCAAATTTGAATTG
                  Chromosome:
                  1:159730249
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.0865/433
                  HGVS:
                  NC_000001.10:g.159700039A>G, NC_000001.11:g.159730249A>G
                  10.

                  rs10778213 [Homo sapiens]
                    ATAAGCTCAAGAGAAAAGTTGATTA[C/T]TCTCATAGGCACTTCTCCTAATTGT
                    Chromosome:
                    12:103101373
                    Gene:
                    C12orf42 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3470/1738
                    HGVS:
                    NC_000012.11:g.103495151T>C, NC_000012.12:g.103101373T>C, XR_001748690.1:n.665-53047A>G
                    11.

                    rs7953249 [Homo sapiens]
                      CTTGGCCATCGGTGGGATATCTGTC[A/G]ACGGTAAATGGCTTTAGCAAGACCC
                      Chromosome:
                      12:120965921
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4311/2159
                      HGVS:
                      NC_000012.11:g.121403724G>A, NC_000012.12:g.120965921G>A
                      12.

                      rs7553007 [Homo sapiens]
                        TCATACCTAGAAAGTTAAAAACTAC[A/G]TTGCCCAGAACTTTTGCTGCTAAGG
                        Chromosome:
                        1:159728759
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.3444/1725
                        HGVS:
                        NC_000001.10:g.159698549G>A, NC_000001.11:g.159728759G>A
                        13.

                        rs7539471 [Homo sapiens]
                          tgctgctgccaggggatagagcagg[A/G]gcattgttggtgattcgagaaggtt
                          Chromosome:
                          1:65719720
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.1945/974
                          HGVS:
                          NC_000001.10:g.66185403G>A, NC_000001.11:g.65719720G>A
                          14.

                          rs7310409 [Homo sapiens]
                            AGAGACATGACTCACAGGTGGCATC[A/G]GGTCCCTTTGAGTCTCTCTGGTGGG
                            Chromosome:
                            12:120987058
                            Gene:
                            HNF1A (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.4062/2034
                            HGVS:
                            NC_000012.11:g.121424861A>G, NC_000012.12:g.120987058A>G, NG_011731.2:g.13313A>G, NM_000545.5:c.327-1775A>G, NM_000545.6:c.327-1775A>G, NM_001306179.1:c.327-1775A>G, XM_005253931.1:c.327-1775A>G, XM_005253931.3:c.327-1775A>G, XM_005253932.1:c.-25-1775A>G
                            15.

                            rs5010905 [Homo sapiens]
                              tcttttctccaatggttttcaccgc[C/T]gtcctttgagatatctacttccatg
                              Chromosome:
                              1:65733540
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.2165/1084
                              HGVS:
                              NC_000001.10:g.66199223C>T, NC_000001.11:g.65733540C>T
                              16.

                              rs4655537 [Homo sapiens]
                                AATCCTGGATCTATGTAATGGATGT[A/G]TATTGATTGGATATCACTTTTTCAC
                                Chromosome:
                                1:65593118
                                Gene:
                                LEPR (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.3063/1534
                                HGVS:
                                NC_000001.10:g.66058801A>G, NC_000001.11:g.65593118A>G, NG_015831.2:g.177554A>G, NM_001003679.3:c.703+253A>G, NM_001003680.3:c.703+253A>G, NM_001198687.1:c.703+253A>G, NM_001198688.1:c.703+253A>G, NM_001198689.1:c.703+253A>G, NM_002303.5:c.703+253A>G, XM_005270950.1:c.703+253A>G, XM_005270951.1:c.703+253A>G, XM_005270952.1:c.703+253A>G
                                17.

                                rs4433630 [Homo sapiens]
                                  GTAGTTTTTGCTTTTTAAATCCAAT[C/T]TAGAGATTCTGGGAGGATCGTGATG
                                  Chromosome:
                                  12:103256253
                                  Gene:
                                  C12orf42 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency
                                  Global MAF:
                                  T=0.3694/1850
                                  HGVS:
                                  NC_000012.11:g.103650031T>C, NC_000012.12:g.103256253T>C, NR_103526.1:n.1820+7073A>G, XM_017019281.1:c.500+7073A>G, XR_001748690.1:n.594+7073A>G, XR_001748692.1:n.734+7073A>G, XR_001748693.1:n.690+7073A>G, XR_001748694.1:n.665+7073A>G
                                  18.

                                  rs4291477 [Homo sapiens]
                                    CATCTGAGCAGCAGAAAAAGAATGA[A/G]GACAACGGTCCCACTTGGGACAGAA
                                    Chromosome:
                                    1:65725392
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.4569/2288
                                    HGVS:
                                    NC_000001.10:g.66191075G>A, NC_000001.11:g.65725392G>A
                                    19.

                                    rs4131568 [Homo sapiens]
                                      TGCAACTCAAGAACTCTGATAAACA[A/G]TATGTTTGGCATTCTGTTCCTGGAA
                                      Chromosome:
                                      1:159752266
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      T=0.1971/987
                                      HGVS:
                                      NC_000001.10:g.159722056C>T, NC_000001.11:g.159752266C>T
                                      20.

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center