Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 13

2.

rs12470652 [Homo sapiens]
    GTTTTCAGAAATGGAATGTGAAAAA[C/T]TCTGTCTGAAAGAGAAGAGGTTAAA
    Chromosome:
    2:48694299
    Gene:
    LHCGR (GeneView) STON1-GTF2A1L (GeneView)
    Functional Consequence:
    intron variant,missense,upstream variant 2KB,utr variant 5 prime
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Benign
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0120/60
    HGVS:
    CM000664.2:g.48694299T>C, NC_000002.11:g.48921438T>C, NC_000002.12:g.48694299T>C, NG_008193.1:g.66443A>G, NG_033050.1:g.169375T>C, NM_000233.3:c.872A>G, NM_001198593.1:c.3441+22619T>C, NP_000224.2:p.Asn291Ser, XP_011531130.1:p.Asn266Ser, XP_011531133.1:p.Asn79Ser, XP_016859578.1:p.Asn206Ser, XP_016859579.1:p.Asn79Ser
    3.

    rs5030775 [Homo sapiens]
      GTTGCTGCTGCTGAGCATGGGCGGG[A/G]CATGGGCATCCAGGGAGCCGCTTCG
      Chromosome:
      19:49016678
      Gene:
      LHB (GeneView)
      Functional Consequence:
      missense
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.0078/39
      HGVS:
      CM000681.2:g.49016678C>T, NC_000019.10:g.49016678C>T, NC_000019.9:g.49519935C>T, NG_011464.1:g.5413G>A, NG_033041.1:g.27780C>T, NM_000894.2:c.52G>A, NP_000885.1:p.Ala18Thr, XP_005258989.1:p.Ala34Thr, XP_011525277.1:p.Ala34Thr
      4.

      rs4539842 [Homo sapiens]
        CGCTCGTGgcagcggcggctgcagc[A/T]gcagcagcagcttcagcagctgcag
        Chromosome:
        2:48755625
        Gene:
        LHCGR (GeneView) STON1-GTF2A1L (GeneView)
        Functional Consequence:
        intron variant,missense
        Validated:
        by cluster
        HGVS:
        CM000664.2:g.48755625A>T, NC_000002.11:g.48982764A>T, NC_000002.12:g.48755625A>T, NG_008193.1:g.5117T>A, NG_033050.1:g.230701A>T, NM_000233.3:c.47T>A, NM_001198593.1:c.3442-20655A>T, NP_000224.2:p.Leu16Gln, XP_011531130.1:p.Leu16Gln
        5.

        rs4287687 [Homo sapiens]
          GCCCTGAGGTGGCAGCATCTGCCCC[C/G/T]GGCCCCAGGCAGCTCACCATGGTGG
          Chromosome:
          19:49016529
          Gene:
          LHB (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 2hit 2allele,by cluster,by frequency
          HGVS:
          CM000681.2:g.49016529T>C, CM000681.2:g.49016529T>G, NC_000019.10:g.49016529T>C, NC_000019.10:g.49016529T>G, NC_000019.9:g.49519786T>C, NC_000019.9:g.49519786T>G, NG_011464.1:g.5562A>C, NG_011464.1:g.5562A>G, NG_033041.1:g.27631T>C, NG_033041.1:g.27631T>G, NM_000894.2:c.183+18A>C, NM_000894.2:c.183+18A>G
          6.

          rs4073366 [Homo sapiens]
            GAGTACACAGCGCTCCCGTCGCGGC[C/G]CCCTTGATGCAGGACCCTCCATCGC
            Chromosome:
            2:48755483
            Gene:
            LHCGR (GeneView) STON1-GTF2A1L (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            G=0.1745/874
            HGVS:
            CM000664.2:g.48755483C>G, NC_000002.11:g.48982622C>G, NC_000002.12:g.48755483C>G, NG_008193.1:g.5259G>C, NG_033050.1:g.230559C>G, NM_000233.3:c.161+28G>C, NM_001198593.1:c.3442-20797C>G
            7.

            rs4002462 [Homo sapiens]
              CTGGGACAAGGACACTGCTTCACCC[A/G]GGTCTGAGACCGCAGCCCCGAGTCC
              Chromosome:
              19:49016740
              Gene:
              LHB (GeneView)
              Functional Consequence:
              intron variant,missense
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              A=0.4301/2154
              HGVS:
              CM000681.2:g.49016740A>G, NC_000019.10:g.49016740A>G, NC_000019.9:g.49519997A>G, NG_011464.1:g.5351T>C, NG_033041.1:g.27842A>G, NM_000894.2:c.16-26T>C, XP_005258989.1:p.Leu13Pro, XP_011525277.1:p.Leu13Pro
              8.

              rs3956233 [Homo sapiens]
                CCCACAAAGACCCAGAGACCCTTCC[C/T]GGCATCTCCTATTCAGGACCCACCA
                Chromosome:
                19:49016819
                Gene:
                LHB (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.0527/264
                HGVS:
                CM000681.2:g.49016819C>T, NC_000019.10:g.49016819C>T, NC_000019.9:g.49520076C>T, NG_011464.1:g.5272G>A, NG_033041.1:g.27921C>T, NM_000894.2:c.16-105G>A
                9.

                rs2387588 [Homo sapiens]
                  GGTGGCAGCATCTGCCCCTGGCCCC[A/G]GGCAGCTCACCATGGTGGGGCAGTA
                  Chromosome:
                  19:49016536
                  Gene:
                  LHB (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.4289/2148
                  HGVS:
                  CM000681.2:g.49016536A>G, NC_000019.10:g.49016536A>G, NC_000019.9:g.49519793A>G, NG_011464.1:g.5555T>C, NG_033041.1:g.27638A>G, NM_000894.2:c.183+11T>C
                  10.

                  rs2293275 [Homo sapiens]
                    TGTGAAAGCACAGTAAGGAAAGTGA[A/G]TAACAAAACACTGTAAGTATTTGCA
                    Chromosome:
                    2:48694236
                    Gene:
                    LHCGR (GeneView) STON1-GTF2A1L (GeneView)
                    Functional Consequence:
                    intron variant,missense,upstream variant 2KB
                    Clinical significance:
                    Benign
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    T=0.4089/2048
                    HGVS:
                    CM000664.2:g.48694236T>C, NC_000002.11:g.48921375T>C, NC_000002.12:g.48694236T>C, NG_008193.1:g.66506A>G, NG_033050.1:g.169312T>C, NM_000233.3:c.935A>G, NM_001198593.1:c.3441+22556T>C, NP_000224.2:p.Asn312Ser, XP_011531130.1:p.Asn287Ser, XP_011531133.1:p.Asn100Ser, XP_016859578.1:p.Asn227Ser, XP_016859579.1:p.Asn100Ser
                    11.

                    rs1800447 [Homo sapiens]
                      GGCATCCAGGGAGCCGCTTCGGCCA[C/T]GGTGCCACCCCATCAATGCCATCCT
                      Chromosome:
                      19:49016648
                      Gene:
                      LHB (GeneView)
                      Functional Consequence:
                      missense
                      Allele Origin:
                      T(germline)/C(germline)
                      Clinical significance:
                      Benign
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      G=0.0579/290
                      HGVS:
                      CM000681.2:g.49016648A>G, NC_000019.10:g.49016648A>G, NC_000019.9:g.49519905A>G, NG_011464.1:g.5443T>C, NG_033041.1:g.27750A>G, NM_000894.2:c.82T>C, NP_000885.1:p.Trp28Arg, XP_005258989.1:p.Trp44Arg, XP_011525277.1:p.Trp44Arg
                      12.

                      rs1056914 [Homo sapiens]
                        TGGCTGTCGAGAAGGAGGGCTGCCC[A/C/T]GTGTGCATCACCGTCAACACCACCA
                        Chromosome:
                        19:49016598
                        Gene:
                        LHB (GeneView)
                        Functional Consequence:
                        synonymous codon
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        T=0.4810/2409
                        HGVS:
                        CM000681.2:g.49016598T>A, CM000681.2:g.49016598T>G, NC_000019.10:g.49016598T>A, NC_000019.10:g.49016598T>G, NC_000019.9:g.49519855T>G, NG_011464.1:g.5493A>C, NG_011464.1:g.5493A>T, NG_033041.1:g.27700T>A, NG_033041.1:g.27700T>G, NM_000894.2:c.132A>C, NM_000894.2:c.132A>T, NP_000885.1:p.Pro44, XP_005258989.1:p.Pro60, XP_011525277.1:p.Pro60

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center