Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.
2.

rs743572 [Homo sapiens]
    GGTGCCGGCAGGCAAGATAGACAGC[A/G/T]GTGGAGTAGAAGAGCTGTGGCAACT
    Chromosome:
    10:102837395
    Gene:
    CYP17A1 (GeneView)
    Functional Consequence:
    utr variant 5 prime
    Clinical significance:
    Benign
    Validated:
    no info
    Global MAF:
    G=0.4105/2056
    HGVS:
    NC_000010.10:g.104597152A>G, NC_000010.11:g.102837395A>G, NG_007955.1:g.5139T>C, NM_000102.3:c.-34T>C

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center