Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

2.

rs2008720 [Homo sapiens]
    CGCCCCTGCATTCCCCGCTTCGTCC[A/C]GCTGTCCACGGCGCCGGCCTCCCGC
    Chromosome:
    22:18936232
    Gene:
    PRODH (GeneView)
    Functional Consequence:
    intron variant,missense
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4467/2237
    HGVS:
    CM000684.2:g.18936232G>T, NC_000022.10:g.18923745G>T, NC_000022.11:g.18936232G>T, NG_008226.2:g.5322C>A, NG_042897.1:g.58G>T, NM_001195226.1:c.-52+158C>A, NM_016335.4:c.56C>A, NP_057419.4:p.Pro19Gln
    4.

    rs372055 [Homo sapiens]
    • Suspected
    CGCCTCAAGAGCTCCAGCCACAGCA[A/G]CTGCCGCTCCCGATGGGTGCCCTTC
    Chromosome:
    22:18913237
    Gene:
    PRODH (GeneView)
    Functional Consequence:
    synonymous codon
    Allele Origin:
    G(germline)/A(germline,inherited)
    Clinical significance:
    Uncertain significance
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2366/1185
    HGVS:
    CM000684.2:g.18913237G>A, NC_000022.10:g.18900750G>A, NC_000022.11:g.18913237G>A, NG_008226.2:g.28317C>T, NG_009052.1:g.12015G>A, NM_001195226.1:c.1417C>T, NM_016335.4:c.1741C>T, NP_001182155.1:p.Leu473, NP_057419.4:p.Leu581, XP_005261312.1:p.Leu390, XP_005261313.1:p.Leu473
    5.

    rs4680 [Homo sapiens]
      CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA
      Chromosome:
      22:19963748
      Gene:
      COMT (GeneView) MIR4761 (GeneView)
      Functional Consequence:
      missense,upstream variant 2KB
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      A=0.3692/1849
      HGVS:
      CM000684.2:g.19963748G>A, NC_000022.10:g.19951271G>A, NC_000022.11:g.19963748G>A, NG_011526.1:g.27009G>A, NM_000754.3:c.472G>A, NM_001135161.1:c.472G>A, NM_001135162.1:c.472G>A, NM_007310.2:c.322G>A, NP_000745.1:p.Val158Met, NP_001128633.1:p.Val158Met, NP_001128634.1:p.Val158Met, NP_009294.1:p.Val108Met, NR_039918.1:n.-5G>A, XP_005261286.1:p.Val158Met, XP_011528188.1:p.Val196Met, XP_016884083.1:p.Val158Met, XP_016884084.1:p.Val158Met

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center