Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 23

2.

rs12735613 [Homo sapiens]
    ATTATGGAAAAAATGCGACCAATAG[A/G]TTACTACCAAATTTTTTTAATGGGA
    Chromosome:
    1:118341350
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2408/1206
    HGVS:
    NC_000001.10:g.118883973G>A, NC_000001.11:g.118341350G>A
    3.

    rs11107116 [Homo sapiens]
      GCCTAAATCCTAATTATCCAGCTTG[G/T]AAGAGTCCCTGACATCTGAATTTAC
      Chromosome:
      12:93584728
      Gene:
      SOCS2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1695/849
      HGVS:
      NC_000012.11:g.93978504G>T, NC_000012.12:g.93584728G>T, XM_011538929.1:c.592-960G>T, XM_011538935.1:c.591+9555G>T, XR_944810.1:n.1273-960G>T
      4.

      rs10935120 [Homo sapiens]
        aagattaagggataattagtgaact[A/G]gatgatgtgacagaataaaatgtct
        Chromosome:
        3:134514250
        Gene:
        CEP63 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3440/1723
        HGVS:
        NC_000003.11:g.134233092A>G, NC_000003.12:g.134514250A>G, NG_032870.1:g.33518A>G, NM_001042383.1:c.222+6964A>G, NM_001042384.1:c.222+6964A>G, NM_001042400.1:c.222+6964A>G, NM_025180.3:c.222+6964A>G, XM_005247795.1:c.249+6964A>G, XM_005247795.4:c.249+6964A>G, XM_005247796.1:c.222+6964A>G, XM_005247797.1:c.222+6964A>G, XM_005247797.3:c.222+6964A>G, XM_005247798.1:c.249+6964A>G, XM_005247799.1:c.-160+6964A>G, XM_005247799.3:c.-160+6964A>G, XM_005247800.1:c.249+6964A>G, XM_005247801.1:c.249+6964A>G, XM_006713760.3:c.222+6964A>G, XM_011513194.2:c.222+6964A>G, XM_011513197.2:c.-7+785A>G, XM_017007244.1:c.270+6964A>G, XM_017007245.1:c.270+6964A>G, XM_017007246.1:c.222+6964A>G, XM_017007247.1:c.222+6964A>G, XM_017007248.1:c.222+6964A>G, XM_017007249.1:c.222+6964A>G, XM_017007250.1:c.270+6964A>G, XM_017007251.1:c.270+6964A>G, XM_017007252.1:c.-160+6964A>G, XM_017007253.1:c.270+6964A>G, XM_017007254.1:c.222+6964A>G, XM_017007255.1:c.222+6964A>G, XM_017007256.1:c.222+6964A>G, XM_017007257.1:c.270+6964A>G, XM_017007258.1:c.222+6964A>G, XM_017007259.1:c.222+6964A>G, XM_017007260.1:c.270+6964A>G, XM_017007261.1:c.249+6964A>G, XM_017007262.1:c.222+6964A>G, XM_017007263.1:c.222+6964A>G, XM_017007264.1:c.222+6964A>G, XM_017007265.1:c.270+6964A>G, XM_017007266.1:c.222+6964A>G, XM_017007267.1:c.222+6964A>G, XM_017007268.1:c.138+6964A>G, XM_017007269.1:c.-160+6964A>G, XR_001740276.1:n.379+6964A>G, XR_001740277.1:n.276+6964A>G, XR_001740278.1:n.276+6964A>G, XR_001740279.1:n.285+6964A>G, XR_001740280.1:n.560+6964A>G, XR_001740281.1:n.276+6964A>G, XR_001740282.1:n.560+6964A>G, XR_001740283.1:n.381+6964A>G, XR_001740284.1:n.381+6964A>G, XR_001740285.1:n.560+6964A>G
        6.

        rs10512248 [Homo sapiens]
          GGATGTAGCCCACGATATGTTCTGA[A/C]GTAAATGGCTTTCCAGTTTTCTCCT
          Chromosome:
          9:95497421
          Gene:
          PTCH1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3299/1652
          HGVS:
          NC_000009.11:g.98259703T>G, NC_000009.12:g.95497421T>G, NG_007664.1:g.24545A>C, NM_000264.3:c.394+8986A>C, NM_001083602.1:c.196+8986A>C, NM_001083603.1:c.391+8986A>C, NM_001083604.1:c.-60+8986A>C, NM_001083605.1:c.-60+8986A>C, NM_001083606.1:c.-60+8986A>C, NM_001083607.1:c.-60+8986A>C, XM_005252103.1:c.-95+8986A>C, XR_242599.1:n.785+8986A>C
          7.

          rs8099594 [Homo sapiens]
            GATGAAGGTCAAACAGAACCTGTCC[A/C/G/T]GGGAAGGGCAGTCAGGATGGTGAGA
            Chromosome:
            18:49464790
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4641/2324
            HGVS:
            NC_000018.10:g.49464790A>C, NC_000018.10:g.49464790A>G, NC_000018.10:g.49464790A>T, NC_000018.9:g.46991160A>G, NG_009239.1:g.920T>A, NG_009239.1:g.920T>C, NG_009239.1:g.920T>G
            8.

            rs8041863 [Homo sapiens]
              ACTGGGCAGGTTGAGTAGAAAGTGT[A/T]TGAATGCCATTGTATGATCTGAGCT
              Chromosome:
              15:88816458
              Gene:
              ACAN (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3568/1787
              HGVS:
              NC_000015.10:g.88816458T>A, NC_000015.9:g.89359689T>A, NG_012794.1:g.18016T>A, NM_001135.3:c.-8+12649T>A, NM_013227.3:c.-8+12649T>A, XM_006720419.1:c.-8+12649T>A, XM_011521313.1:c.-8+12649T>A, XM_011521314.1:c.-8+12649T>A, XM_017021985.1:c.-8+12649T>A, XM_017021986.1:c.-8+12649T>A, XM_017021987.1:c.-8+12649T>A
              9.

              rs6854783 [Homo sapiens]
                CAAAAAAAAAAAAAAAGCAACTTCC[A/G]AGGAAACAGAAAAGGAATTAAGTTT
                Chromosome:
                4:144721927
                Gene:
                HHIP (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4155/2081
                HGVS:
                NC_000004.11:g.145643079G>A, NC_000004.12:g.144721927G>A, NG_011496.1:g.80907G>A, NM_022475.2:c.1760+2971G>A, XM_005263178.1:c.1760+2971G>A, XM_005263178.4:c.1760+2971G>A, XM_006714288.3:c.1760+2971G>A
                10.

                rs6724465 [Homo sapiens]
                  AGTTTCATACACTTGGCTGAACTGC[A/G]TTGAGGTAATGGCTGAAGACTGAAC
                  Chromosome:
                  2:219079124
                  Gene:
                  NHEJ1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.1080/541
                  HGVS:
                  NC_000002.11:g.219943846G>A, NC_000002.12:g.219079124G>A, NG_007880.1:g.86742C>T, NM_024782.2:c.589-918C>T
                  11.

                  rs6686842 [Homo sapiens]
                    attttgtagacagcaacaaattgaa[C/T]cagctgggggtggtggctcacacct
                    Chromosome:
                    1:41065199
                    Gene:
                    SCMH1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3381/1693
                    HGVS:
                    NC_000001.10:g.41530871T>C, NC_000001.11:g.41065199T>C, NM_001031694.2:c.1075+5396A>G, NM_001172218.1:c.892+5396A>G, NM_001172219.1:c.1105+5396A>G, NM_001172220.1:c.892+5396A>G, NM_001172221.1:c.892+5396A>G, NM_001172222.2:c.601+5396A>G, NM_012236.3:c.934+5396A>G, NR_135092.1:n.1444+5396A>G, XM_005270637.1:c.1105+5396A>G, XM_005270638.1:c.1075+5396A>G, XM_005270639.1:c.892+5396A>G, XM_005270640.1:c.892+5396A>G, XM_006710462.2:c.1105+5396A>G, XM_006710464.1:c.892+5396A>G, XM_011541032.2:c.1105+5396A>G, XM_011541033.2:c.1075+5396A>G, XM_011541034.1:c.1105+5396A>G, XM_011541035.2:c.934+5396A>G, XM_011541036.2:c.892+5396A>G, XM_011541039.1:c.746-16309A>G, XM_011541040.2:c.1105+5396A>G, XM_011541043.2:c.571+5396A>G, XM_011541044.1:c.571+5396A>G, XM_011541045.2:c.802+5396A>G, XM_017000698.1:c.1015+5396A>G, XM_017000699.1:c.892+5396A>G, XM_017000700.1:c.934+5396A>G, XM_017000701.1:c.772+5396A>G, XM_017000702.1:c.802+5396A>G, XM_017000703.1:c.802+5396A>G, XM_017000704.1:c.772+5396A>G, XM_017000705.1:c.601+5396A>G, XM_017000706.1:c.559+5396A>G, XM_017000707.1:c.601+5396A>G, XM_017000708.1:c.533-16309A>G, XM_017000709.1:c.571+5396A>G, XM_017000710.1:c.559+5396A>G, XM_017000711.1:c.533-16309A>G, XM_017000712.1:c.533-16309A>G, XM_017000713.1:c.443-16309A>G, XR_001737045.1:n.1307+5396A>G, XR_001737046.1:n.1307+5396A>G, XR_001737047.1:n.1307+5396A>G, XR_001737048.1:n.1307+5396A>G, XR_001737049.1:n.1307+5396A>G, XR_001737050.1:n.1307+5396A>G, XR_001737051.1:n.1307+5396A>G, XR_001737052.1:n.1256+5396A>G, XR_001737053.1:n.1455+5396A>G, XR_001737054.1:n.1256+5396A>G, XR_246251.1:n.1286+5396A>G, XR_946584.2:n.1307+5396A>G
                    12.

                    rs6440003 [Homo sapiens]
                      AACCTTTAGGTAAGAGACAAAAGGC[A/G]CCAATGAGAAGATTCACTCCTGAGG
                      Chromosome:
                      3:141375367
                      Gene:
                      ZBTB38 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4928/2468
                      HGVS:
                      NC_000003.11:g.141094209G>A, NC_000003.12:g.141375367G>A, NG_021426.1:g.56155G>A, NM_001080412.2:c.-480+5421G>A
                      14.

                      rs4549631 [Homo sapiens]
                        GGCTGCTGTGGAAACTTTTTGCTCT[C/T]CTGGTACAATGTCATAGCTTTTCCT
                        Chromosome:
                        6:126645162
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        T=0.3988/1997
                        HGVS:
                        NC_000006.11:g.126966308T>C, NC_000006.12:g.126645162T>C
                        15.

                        rs3791675 [Homo sapiens]
                          GTCAAAGAAATTCAGTCTGTTTATA[A/G]CCTTTAGCATTAGATAAACCACCAA
                          Chromosome:
                          2:55884174
                          Gene:
                          EFEMP1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.2905/1455
                          HGVS:
                          NC_000002.11:g.56111309C>T, NC_000002.12:g.55884174C>T, NG_009098.1:g.44624G>A, NM_001039348.2:c.518-2440G>A, NM_001039349.2:c.518-2440G>A, XM_005264204.1:c.908-2440G>A, XM_005264205.1:c.908-2440G>A, XM_005264205.4:c.908-2440G>A, XM_017003586.1:c.518-2440G>A
                          16.

                          rs3116602 [Homo sapiens]
                            tcctggtgctctccagtgtacttcc[G/T]cattcatgctagtgaaaatacagtt
                            Chromosome:
                            13:50537219
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.0863/432
                            HGVS:
                            NC_000013.10:g.51111355T>G, NC_000013.11:g.50537219T>G, XR_245432.1:n.1889+34339T>G
                            17.

                            rs2814993 [Homo sapiens]
                              AATAACATGCCTGATACTCAGTAAC[A/G]GGTGGCCAGATTCTCCTTAACCAAA
                              Chromosome:
                              6:34651116
                              Gene:
                              C6orf106 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              A=0.1156/579
                              HGVS:
                              NC_000006.11:g.34618893G>A, NC_000006.12:g.34651116G>A, NM_022758.5:c.313+3509C>T, NM_024294.3:c.313+3509C>T, XM_005249298.1:c.313+3509C>T, XM_005249298.2:c.313+3509C>T, XR_926300.2:n.507+3509C>T
                              18.

                              rs2282978 [Homo sapiens]
                                GGATGACTCATTGCATTGGATCATC[C/T]TTGGGAAACCACCTACTAAGCAGAA
                                Chromosome:
                                7:92635096
                                Gene:
                                CDK6 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.3141/1573
                                HGVS:
                                NC_000007.13:g.92264410T>C, NC_000007.14:g.92635096T>C, NG_015888.1:g.206532A>G, NM_001145306.1:c.648-12010A>G, NM_001259.6:c.648-12010A>G, XM_006715835.2:c.648-12010A>G
                                19.

                                rs2055059 [Homo sapiens]
                                  CCAGAGATGGCTCCAGAGATGGGCC[C/G/T]TGTTCATTGCATAGAACACATTATG
                                  Chromosome:
                                  4:144676607
                                  Gene:
                                  HHIP (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  A=0.3804/1905
                                  HGVS:
                                  NC_000004.11:g.145597759A>C, NC_000004.11:g.145597759A>G, NC_000004.12:g.144676607A>C, NC_000004.12:g.144676607A>G, NG_011496.1:g.35587A>C, NG_011496.1:g.35587A>G, NM_022475.2:c.831+16769A>C, NM_022475.2:c.831+16769A>G, XM_005263178.1:c.831+16769A>C, XM_005263178.1:c.831+16769A>G, XM_005263178.4:c.831+16769A>C, XM_005263178.4:c.831+16769A>G, XM_006714288.3:c.831+16769A>C, XM_006714288.3:c.831+16769A>G
                                  20.

                                  rs1863913 [Homo sapiens]
                                    GTTTTGAAAGGCTTTGGGACATGGT[A/G]AGTCATTCACTGTGGATGAAGAATA
                                    Chromosome:
                                    3:134481363
                                    Gene:
                                    ANAPC13 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    C=0.3474/1740
                                    HGVS:
                                    NC_000003.11:g.134200205C>T, NC_000003.12:g.134481363C>T, NG_032870.1:g.631C>T, NM_001242374.1:c.99+1443G>A, NM_001242375.1:c.99+1443G>A, NM_015391.3:c.99+1443G>A

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center