Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 21

1.

rs17036101 [Homo sapiens]
    GAGCCTTAATTAATTTTCTTCTGCC[A/G/T]GAACCAATGCTTTAATGTTGGTATT
    Chromosome:
    3:12236345
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0333/167
    HGVS:
    NC_000003.11:g.12277845G>A, NC_000003.12:g.12236345G>A, NC_000003.12:g.12236345G>T
    2.

    rs12779790 [Homo sapiens]
      cccggACAatgttgggaattttttc[A/G]tatttcttggccatttatatatctt
      Chromosome:
      10:12286011
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1579/791
      HGVS:
      NC_000010.10:g.12328010A>G, NC_000010.11:g.12286011A>G
      3.

      rs10923931 [Homo sapiens]
        CTTGTTGCTCCATCCTCTGGCTTCA[G/T]GCTGAACAAGTAAGATTATGGGCAC
        Chromosome:
        1:119975336
        Gene:
        NOTCH2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1921/962
        HGVS:
        NC_000001.10:g.120517959G>T, NC_000001.11:g.119975336G>T, NG_008163.1:g.99318C>A, NM_001200001.1:c.875-5592C>A, NM_024408.3:c.875-5592C>A, NW_003871056.3:g.46910G>T, XM_005270901.1:c.758-5592C>A, XM_005270901.3:c.758-5592C>A, XM_005270902.1:c.758-5592C>A, XM_011541519.2:c.863-5592C>A, XM_011541520.2:c.758-5592C>A, XM_017001372.1:c.827-5592C>A, XM_017001373.1:c.758-5592C>A
        4.

        rs10490072 [Homo sapiens]
          CTTCTTTGGTTATGTATATACATGC[C/T]TGCTTATTCTAATCCATGCCTTTAT
          Chromosome:
          2:60442796
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1214/608
          HGVS:
          NC_000002.11:g.60669931T>C, NC_000002.12:g.60442796T>C
          5.

          rs9472138 [Homo sapiens]
            TTACCCTAAGCACGTTCTCCTCATA[C/T]CGTTTGTCGTCAATCCCTACCACGG
            Chromosome:
            6:43844025
            Gene:
            LOC107986598 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1929/966
            HGVS:
            NC_000006.11:g.43811762C>T, NC_000006.12:g.43844025C>T, XR_001744131.1:n.2589+1392C>T, XR_001744132.1:n.2590-1251C>T
            6.
            7.

            rs7961581 [Homo sapiens]
              CTGGATGCCAAAGCTCAGGAGTAAA[C/T]GAGGATGAAAAGTAGTTATCAACTC
              Chromosome:
              12:71269322
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2384/1194
              HGVS:
              NC_000012.11:g.71663102C>T, NC_000012.12:g.71269322C>T
              8.

              rs7903146 [Homo sapiens]
                TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG
                Chromosome:
                10:112998590
                Gene:
                TCF7L2 (GeneView)
                Functional Consequence:
                intron variant
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                drug-response
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2278/1141
                HGVS:
                NC_000010.10:g.114758349C>T, NC_000010.11:g.112998590C>T, NG_012631.1:g.53341C>T, NM_001146274.1:c.450+33966C>T, NM_001146283.1:c.382-41435C>T, NM_001146284.1:c.382-41435C>T, NM_001146285.1:c.382-41435C>T, NM_001146286.1:c.382-41435C>T, NM_001198525.1:c.382-41435C>T, NM_001198526.1:c.382-41435C>T, NM_001198527.1:c.382-41435C>T, NM_001198528.1:c.382-41435C>T, NM_001198529.1:c.382-41435C>T, NM_001198530.1:c.381+46983C>T, NM_001198531.1:c.450+33966C>T, NM_030756.4:c.382-41435C>T, XM_005270071.1:c.450+33966C>T, XM_005270072.1:c.450+33966C>T, XM_005270073.1:c.450+33966C>T, XM_005270074.1:c.450+33966C>T, XM_005270075.1:c.450+33966C>T, XM_005270076.1:c.450+33966C>T, XM_005270077.1:c.450+33966C>T, XM_005270078.1:c.450+33966C>T, XM_005270079.1:c.450+33966C>T, XM_005270080.1:c.382-41435C>T, XM_005270081.1:c.382-41435C>T, XM_005270082.1:c.450+33966C>T, XM_005270083.1:c.450+33966C>T, XM_005270084.1:c.450+33966C>T, XM_005270085.1:c.450+33966C>T, XM_005270086.1:c.382-41435C>T, XM_005270087.1:c.382-41435C>T, XM_005270088.1:c.382-41435C>T, XM_005270089.1:c.382-41435C>T, XM_005270090.1:c.381+46983C>T, XM_005270091.1:c.450+33966C>T, XM_005270091.2:c.450+33966C>T, XM_005270092.1:c.450+33966C>T, XM_005270093.1:c.450+33966C>T, XM_005270093.2:c.450+33966C>T, XM_005270094.1:c.450+33966C>T, XM_005270094.2:c.450+33966C>T, XM_005270095.1:c.450+33966C>T, XM_005270096.1:c.450+33966C>T, XM_005270096.2:c.450+33966C>T, XM_005270100.1:c.450+33966C>T, XM_005270101.1:c.382-41435C>T, XM_005270101.2:c.382-41435C>T, XM_005270102.1:c.450+33966C>T, XM_005270103.1:c.382-41435C>T, XM_005270104.1:c.382-41435C>T, XM_011540109.1:c.450+33966C>T, XM_011540110.1:c.382-41435C>T, XM_011540111.1:c.382-41435C>T, XM_011540113.2:c.450+33966C>T, XM_011540116.1:c.450+33966C>T, XM_017016584.1:c.450+33966C>T, XM_017016585.1:c.450+33966C>T, XM_017016586.1:c.450+33966C>T, XM_017016587.1:c.450+33966C>T, XM_017016588.1:c.382-41435C>T, XM_017016589.1:c.450+33966C>T, XM_017016590.1:c.450+33966C>T, XM_017016591.1:c.450+33966C>T, XM_017016592.1:c.450+33966C>T, XM_017016593.1:c.450+33966C>T, XM_017016594.1:c.382-41435C>T, XM_017016595.1:c.450+33966C>T, XM_017016596.1:c.450+33966C>T
                10.

                rs7020996 [Homo sapiens]
                  TGACATAAGGTGAGGAAAAGAAGAA[A/C/T]AACTTTTGGGAAAAGTAACTGTGAG
                  Chromosome:
                  9:22129580
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2584/1294
                  HGVS:
                  NC_000009.11:g.22129579C>T, NC_000009.12:g.22129580C>A, NC_000009.12:g.22129580C>T
                  12.

                  rs5015480 [Homo sapiens]
                    GAAGTAAACTCGAATGTTGATTATA[C/T]GTTTTCTATCAAATTATTCAAGTAT
                    Chromosome:
                    10:92705802
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.4549/2278
                    HGVS:
                    NC_000010.10:g.94465559C>T, NC_000010.11:g.92705802C>T
                    13.

                    rs4607103 [Homo sapiens]
                      ATAATTCCTCAGGCCCAGCAGGTTT[C/T]TCAACTTGACTTTTCTTAGGTTATT
                      Chromosome:
                      3:64726228
                      Gene:
                      ADAMTS9-AS2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      T=0.3540/1773
                      HGVS:
                      NC_000003.11:g.64711904C>T, NC_000003.12:g.64726228C>T, NR_038264.1:n.469+40890C>T
                      15.

                      rs2934381 [Homo sapiens]
                        ATGTTTCAGACTGTTGGCATATGCT[C/T]AGATACCTAAAAAACAGTCCTGATT
                        Chromosome:
                        1:119963485
                        Gene:
                        NOTCH2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        A=0.1921/962
                        HGVS:
                        NC_000001.10:g.120506108G>A, NC_000001.11:g.119963485G>A, NG_008163.1:g.111169C>T, NM_001200001.1:c.1915+89C>T, NM_024408.3:c.1915+89C>T, NW_003871056.3:g.35059G>A, XM_005270901.1:c.1798+89C>T, XM_005270901.3:c.1798+89C>T, XM_005270902.1:c.1798+89C>T, XM_011541519.2:c.1903+89C>T, XM_011541520.2:c.1798+89C>T, XM_017001372.1:c.1867+89C>T, XM_017001373.1:c.1798+89C>T
                        16.

                        rs2793831 [Homo sapiens]
                          CTTAGATGCTTCCCCATTCCCACCA[C/T]TGTTTCTTTCAAATTCACATTCACA
                          Chromosome:
                          1:119981279
                          Gene:
                          NOTCH2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.1927/965
                          HGVS:
                          NC_000001.10:g.120523902T>C, NC_000001.11:g.119981279T>C, NG_008163.1:g.93375A>G, NM_001200001.1:c.874+5681A>G, NM_024408.3:c.874+5681A>G, NW_003871056.3:g.52853T>C, XM_005270901.1:c.757+5681A>G, XM_005270901.3:c.757+5681A>G, XM_005270902.1:c.757+5681A>G, XM_011541519.2:c.862+5681A>G, XM_011541520.2:c.757+5681A>G, XM_017001372.1:c.826+5681A>G, XM_017001373.1:c.757+5681A>G
                          17.

                          rs2641348 [Homo sapiens]
                            CAATACTGCCAATGTAGGGGTAGGC[C/T]TAATTGCATCATGGGCTCAGGACGC
                            Chromosome:
                            1:119895261
                            Gene:
                            ADAM30 (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            G=0.1959/981
                            HGVS:
                            NC_000001.10:g.120437884A>G, NC_000001.11:g.119895261A>G, NM_021794.3:c.1076T>C, NP_068566.2:p.Leu359Pro
                            18.

                            rs1801282 [Homo sapiens]
                              AACTCTGGGAGATTCTCCTATTGAC[C/G]CAGAAAGCGATTCCTTCACTGATAC
                              Chromosome:
                              3:12351626
                              Gene:
                              PPARG (GeneView)
                              Functional Consequence:
                              intron variant,missense
                              Allele Origin:
                              G(germline)/C(germline)
                              Clinical significance:
                              Likely benign
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.0703/352
                              HGVS:
                              NC_000003.11:g.12393125C>G, NC_000003.12:g.12351626C>G, NG_011749.1:g.68777C>G, NM_001330615.1:c.-2-28078C>G, NM_005037.5:c.-2-28078C>G, NM_015869.4:c.34C>G, NM_138711.3:c.-2-28078C>G, NM_138712.3:c.-2-28078C>G, NP_056953.2:p.Pro12Ala, XM_011533841.2:c.-2-28078C>G, XM_011533842.2:c.34C>G, XM_011533843.2:c.34C>G, XM_011533844.1:c.-2-28078C>G, XP_011532144.1:p.Pro12Ala, XP_011532145.1:p.Pro12Ala
                              19.

                              rs1153188 [Homo sapiens]
                                TAGCAAGGTGAGAAGTTCTTCTGAA[A/T]TGCAGTATAAAAGATAAAAAGAAAT
                                Chromosome:
                                12:54705212
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.1823/913
                                HGVS:
                                NC_000012.11:g.55098996T>A, NC_000012.12:g.54705212T>A
                                20.

                                rs864745 [Homo sapiens]
                                  ATTTCCTACAACCATTCAAAACATT[A/G]TAACAGTTCAAATTATATTTGAGCA
                                  Chromosome:
                                  7:28140937
                                  Gene:
                                  JAZF1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.3027/1516
                                  HGVS:
                                  NC_000007.13:g.28180556T>C, NC_000007.14:g.28140937T>C, NG_011499.1:g.44882A>G, NM_175061.3:c.115+39526A>G, XM_006715656.1:c.-140+39526A>G, XM_017011832.1:c.-78+38893A>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center