Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs1143679 [Homo sapiens]
    AGCACAGGCTCATGCGAGCCCATCC[A/G]CCTGCAGGGTGAGTCACTGCCCCGC
    Chromosome:
    16:31265490
    Gene:
    ITGAM (GeneView)
    Functional Consequence:
    missense,nc transcript variant,synonymous codon
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0851/426
    HGVS:
    CM000678.2:g.31265490G>A, NC_000016.10:g.31265490G>A, NC_000016.9:g.31276811G>A, NG_011719.1:g.10524G>A, NM_000632.3:c.230G>A, NM_001145808.1:c.230G>A, NP_000623.2:p.Arg77His, NP_001139280.1:p.Arg77His, XP_006721108.1:p.Arg77His, XP_011544152.1:p.Pro5, XP_011544153.1:p.Arg77His, XP_016878705.1:p.Arg77His, XR_950796.1:n.320G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center