Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs11571302 [Homo sapiens]
    AATAGGAGCTTTCTCAGTGTACTGC[A/C/T]GGCTTTGCTGACAGACTGTTTATTG
    Chromosome:
    2:203878211
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.4287/2147
    HGVS:
    CM000664.2:g.203878211G>A, CM000664.2:g.203878211G>T, NC_000002.11:g.204742934G>T
    2.

    rs11571297 [Homo sapiens]
      GTCTTTTTTTGCTTTGACCCCAGAT[A/G]TTCCTACACTTCAACTTCTGGTAGA
      Chromosome:
      2:203880280
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.4425/2216
      HGVS:
      CM000664.2:g.203880280T>C, NC_000002.11:g.204745003T>C
      3.

      rs10932037 [Homo sapiens]
        ATCATCTTTAATGGGCCAGCATTCT[C/T]ATGGGGTAGAGCAGAATATTCATTT
        Chromosome:
        2:203960623
        Gene:
        ICOS (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Clinical significance:
        Likely benign
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.0633/317
        HGVS:
        CM000664.2:g.203960623C>T, NC_000002.11:g.204825346C>T, NC_000002.12:g.203960623C>T, NG_011586.1:g.28844C>T, NM_012092.3:c.*1024C>T
        4.

        rs3087243 [Homo sapiens]
          TCTTCACCACTATTTGGGATATAAC[A/G]TGGGTTAACACAGACATAGCAGTCC
          Chromosome:
          2:203874196
          Gene:
          CTLA4 (GeneView)
          Functional Consequence:
          downstream variant 500B
          Validated:
          by 1000G,by cluster,by frequency,by submitter
          Global MAF:
          A=0.3690/1848
          HGVS:
          CM000664.2:g.203874196G>A, NC_000002.11:g.204738919G>A, NC_000002.12:g.203874196G>A, NG_011502.1:g.11411G>A, NM_001037631.2:c.*1421G>A, NM_005214.4:c.*1384G>A, XR_241294.1:n.2154G>A
          6.

          rs1863800 [Homo sapiens]
            TGAAGATAAAAAGGAACTGTTTAAA[C/T]TGATAGTAAAGAAAAGCCTTAAATT
            Chromosome:
            2:203837937
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
            Global MAF:
            T=0.4121/2064
            HGVS:
            CM000664.2:g.203837937C>T, NC_000002.11:g.204702660C>T
            7.

            rs231775 [Homo sapiens]
              GCACAAGGCTCAGCTGAACCTGGCT[A/G/T]CCAGGACCTGGCCCTGCACTCTCCT
              Chromosome:
              2:203867991
              Gene:
              CTLA4 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.4273/2140
              HGVS:
              CM000664.2:g.203867991A>G, CM000664.2:g.203867991A>T, NC_000002.11:g.204732714A>G, NC_000002.12:g.203867991A>G, NC_000002.12:g.203867991A>T, NG_011502.1:g.5206A>G, NG_011502.1:g.5206A>T, NM_001037631.2:c.49A>G, NM_001037631.2:c.49A>T, NM_005214.4:c.49A>G, NM_005214.4:c.49A>T, NP_001032720.1:p.Thr17Ala, NP_001032720.1:p.Thr17Ser, NP_005205.2:p.Thr17Ala, NP_005205.2:p.Thr17Ser, XR_241294.1:n.189A>G

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center