Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs111033448 [Homo sapiens]
    TGGGGAATCTGGGGCCGGGAAGACG[-/G]AGAGCACAAAGCTGATCCTGCAGTT
    Chromosome:
    11:77156685
    Gene:
    MYO7A (GeneView)
    Functional Consequence:
    frameshift variant,nc transcript variant
    Allele Origin:
    G(germline)/(germline)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000011.10:g.77156685delG, NC_000011.9:g.76867731delG, NG_009086.1:g.33422delG, NM_000260.3:c.496delG, NM_001127179.2:c.496delG, NM_001127180.1:c.496delG, NP_000251.3:p.Glu166Argfs, NP_001120651.2:p.Glu166Argfs, NP_001120652.1:p.Glu166Argfs, NW_003871081.1:g.158321delG, XM_005274011.1:c.496delG, XM_005274012.1:c.496delG, XM_011545044.2:c.496delG, XM_011545046.2:c.586delG, XM_011545050.2:c.238delG, XM_017017778.1:c.586delG, XM_017017779.1:c.586delG, XM_017017780.1:c.586delG, XM_017017781.1:c.586delG, XM_017017782.1:c.586delG, XM_017017783.1:c.586delG, XM_017017784.1:c.586delG, XM_017017785.1:c.586delG, XM_017017786.1:c.586delG, XM_017017787.1:c.586delG, XM_017017788.1:c.586delG, XP_005274068.1:p.Glu166Argfs, XP_005274069.1:p.Glu166Argfs, XP_011543346.1:p.Glu166Argfs, XP_011543348.2:p.Glu196Argfs, XP_011543352.1:p.Glu80Argfs, XP_016873267.1:p.Glu196Argfs, XP_016873268.1:p.Glu196Argfs, XP_016873269.1:p.Glu196Argfs, XP_016873270.1:p.Glu196Argfs, XP_016873271.1:p.Glu196Argfs, XP_016873272.1:p.Glu196Argfs, XP_016873273.1:p.Glu196Argfs, XP_016873274.1:p.Glu196Argfs, XP_016873275.1:p.Glu196Argfs, XP_016873276.1:p.Glu196Argfs, XP_016873277.1:p.Glu196Argfs, XR_001747885.1:n.601delG, XR_001747886.1:n.601delG, XR_001747887.1:n.601delG, XR_001747888.1:n.601delG, XR_001747889.1:n.601delG
    2.

    rs111033283 [Homo sapiens]
      CCGCAATGACAACTCAAGCCGTTTC[A/G]GAAAGTACATCGACATCCACTTCAA
      Chromosome:
      11:77156909
      Gene:
      MYO7A (GeneView)
      Functional Consequence:
      missense,nc transcript variant
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster
      HGVS:
      NC_000011.10:g.77156909G>A, NC_000011.9:g.76867955G>A, NG_009086.1:g.33646G>A, NM_000260.3:c.640G>A, NM_001127179.2:c.640G>A, NM_001127180.1:c.640G>A, NP_000251.3:p.Gly214Arg, NP_001120651.2:p.Gly214Arg, NP_001120652.1:p.Gly214Arg, NW_003871081.1:g.158545G>A, XM_005274011.1:c.640G>A, XM_005274012.1:c.640G>A, XM_011545044.2:c.640G>A, XM_011545046.2:c.730G>A, XM_011545050.2:c.382G>A, XM_017017778.1:c.730G>A, XM_017017779.1:c.730G>A, XM_017017780.1:c.730G>A, XM_017017781.1:c.730G>A, XM_017017782.1:c.730G>A, XM_017017783.1:c.730G>A, XM_017017784.1:c.730G>A, XM_017017785.1:c.730G>A, XM_017017786.1:c.730G>A, XM_017017787.1:c.730G>A, XM_017017788.1:c.730G>A, XP_005274068.1:p.Gly214Arg, XP_005274069.1:p.Gly214Arg, XP_011543346.1:p.Gly214Arg, XP_011543348.2:p.Gly244Arg, XP_011543352.1:p.Gly128Arg, XP_016873267.1:p.Gly244Arg, XP_016873268.1:p.Gly244Arg, XP_016873269.1:p.Gly244Arg, XP_016873270.1:p.Gly244Arg, XP_016873271.1:p.Gly244Arg, XP_016873272.1:p.Gly244Arg, XP_016873273.1:p.Gly244Arg, XP_016873274.1:p.Gly244Arg, XP_016873275.1:p.Gly244Arg, XP_016873276.1:p.Gly244Arg, XP_016873277.1:p.Gly244Arg, XR_001747885.1:n.745G>A, XR_001747886.1:n.745G>A, XR_001747887.1:n.745G>A, XR_001747888.1:n.745G>A, XR_001747889.1:n.745G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center