Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs11200638 [Homo sapiens]
    AGCTCCGCGGACGCTGCCTTCGTCC[A/G]GCCGCAGAGGCCCCGCGGTCAGGGT
    Chromosome:
    10:122461028
    Gene:
    HTRA1 (GeneView) LOC105378525 (GeneView)
    Functional Consequence:
    nc transcript variant,upstream variant 2KB
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.2895/1450
    HGVS:
    NC_000010.10:g.124220544G>A, NC_000010.11:g.122461028G>A, NG_011554.1:g.4504G>A, NM_002775.4:c.-625G>A, XR_946382.1:n.331C>T, XR_946383.1:n.331C>T, XR_946384.1:n.331C>T, XR_946385.1:n.331C>T
    2.

    rs10490924 [Homo sapiens]
      TTTATCACACTCCATGATCCCAGCT[G/T]CTAAAATCCACACTGAGCTCTGCTT
      Chromosome:
      10:122454932
      Gene:
      ARMS2 (GeneView) LOC105378525 (GeneView)
      Functional Consequence:
      downstream variant 500B,intron variant,missense
      Allele Origin:
      G(germline)/T(germline)
      Clinical significance:
      other
      Validated:
      no info
      Global MAF:
      T=0.2865/1435
      HGVS:
      NC_000010.10:g.124214448G>T, NC_000010.11:g.122454932G>T, NG_011725.1:g.5270G>T, NM_001099667.1:c.205G>T, NP_001093137.1:p.Ala69Ser, XR_946382.1:n.1827+3563C>A, XR_946383.1:n.1827+3563C>A, XR_946384.1:n.1576+3563C>A, XR_946385.1:n.1917C>A
      3.

      rs10490923 [Homo sapiens]
        TATGTCCCTGTACCCTACATGCTGC[A/G]CCTATACCCAGGACCGATGGTAACT
        Chromosome:
        10:122454735
        Gene:
        ARMS2 (GeneView) LOC105378525 (GeneView)
        Functional Consequence:
        downstream variant 500B,intron variant,missense
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0751/376
        HGVS:
        NC_000010.10:g.124214251G>A, NC_000010.11:g.122454735G>A, NG_011725.1:g.5073G>A, NM_001099667.1:c.8G>A, NP_001093137.1:p.Arg3His, XR_946382.1:n.1827+3760C>T, XR_946383.1:n.1827+3760C>T, XR_946384.1:n.1576+3760C>T, XR_946385.1:n.2114C>T
        4.

        rs6677604 [Homo sapiens]
          CATAGTTGCCCTGAGAAAATGCGAG[A/G]GGAAAGGACTCACAGCTACTGTGGA
          Chromosome:
          1:196717788
          Gene:
          CFH (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2434/1219
          HGVS:
          NC_000001.10:g.196686918G>A, NC_000001.11:g.196717788G>A, NG_007259.1:g.70778G>A, NM_000186.3:c.1696+2019G>A
          5.

          rs3753396 [Homo sapiens]
            TAATGAAGGGACCTAATAAAATTCA[A/G]TGTGTTGATGGAGAGTGGACAACTT
            Chromosome:
            1:196726612
            Gene:
            CFH (GeneView)
            Functional Consequence:
            synonymous codon
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.2029/1016
            HGVS:
            NC_000001.10:g.196695742A>G, NC_000001.11:g.196726612A>G, NG_007259.1:g.79602A>G, NM_000186.3:c.2016A>G, NP_000177.2:p.Gln672
            6.

            rs3091244 [Homo sapiens]
              TACCACGTGCACCCAGATGGCCACT[A/C/T]GTTTAATATGTTACCATTTCCCATT
              Chromosome:
              1:159714875
              Gene:
              CRP (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.2430/1217
              HGVS:
              NC_000001.10:g.159684665G>A, NC_000001.11:g.159714875G>A, NG_013007.1:g.4715C>T, NM_000567.2:c.-390C>T, XM_005244904.1:c.-390C>T, XM_011509207.1:c.-390C>T
              7.

              rs2736911 [Homo sapiens]
                TCCTGTGTCCTTCATTTCCACTCTG[A/C/T]GAGAGTCTGTGCTGGACCCTGGAGT
                Chromosome:
                10:122454839
                Gene:
                ARMS2 (GeneView) LOC105378525 (GeneView)
                Functional Consequence:
                downstream variant 500B,intron variant,stop gained
                Validated:
                by 1000G,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.1144/573
                HGVS:
                NC_000010.10:g.124214355C>T, NC_000010.11:g.122454839C>T, NG_011725.1:g.5177C>T, NM_001099667.1:c.112C>T, NP_001093137.1:p.Arg38Ter, XR_946382.1:n.1827+3656G>A, XR_946383.1:n.1827+3656G>A, XR_946384.1:n.1576+3656G>A, XR_946385.1:n.2010G>A
                8.

                rs2284664 [Homo sapiens]
                  AGAAAAATACCAGTCTCCATAGATC[A/G]TAAAGCAAATAGATGGTCTTAAAAT
                  Chromosome:
                  1:196733395
                  Gene:
                  CFH (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2274/1139
                  HGVS:
                  NC_000001.10:g.196702525C>T, NC_000001.11:g.196733395C>T, NG_007259.1:g.86385C>T, NM_000186.3:c.2414-3429C>T
                  10.

                  rs800292 [Homo sapiens]
                    TCTCCCTTCCTGCATACCATTATTA[C/T]ATTTCCAAGAGATCTATATCCAGGG
                    Chromosome:
                    1:196673103
                    Gene:
                    CFH (GeneView)
                    Functional Consequence:
                    missense
                    Allele Origin:
                    T(germline)/C(germline)
                    Clinical significance:
                    other
                    Validated:
                    no info
                    Global MAF:
                    A=0.4681/2344
                    HGVS:
                    NC_000001.10:g.196642233G>A, NC_000001.11:g.196673103G>A, NG_007259.1:g.26093G>A, NM_000186.3:c.184G>A, NM_001014975.2:c.184G>A, NP_000177.2:p.Val62Ile, NP_001014975.1:p.Val62Ile, XM_005245111.1:c.184G>A, XM_005245112.1:c.184G>A, XP_005245168.1:p.Val62Ile, XP_005245169.1:p.Val62Ile
                    11.

                    rs419137 [Homo sapiens]
                      TGGCCCACCAACCCTGCAGCACATT[A/C]ACTTATTTTGGCTGATATGGAACAA
                      Chromosome:
                      1:196727745
                      Gene:
                      CFH (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.0385/193
                      HGVS:
                      NC_000001.10:g.196696875G>T, NC_000001.11:g.196727745G>T, NG_007259.1:g.80735G>T, NM_000186.3:c.2237-601G>T
                      12.

                      rs1205 [Homo sapiens]
                        ACTTCCAGTTTGGCTTCTGTCCTCA[C/T]AGTCTCTCTCCATGTGGCAAACAAG
                        Chromosome:
                        1:159712443
                        Gene:
                        CRP (GeneView)
                        Functional Consequence:
                        utr variant 3 prime
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.3383/1694
                        HGVS:
                        NC_000001.10:g.159682233C>T, NC_000001.11:g.159712443C>T, NG_013007.1:g.7147G>A, NM_000567.2:c.*1082G>A, XM_005244904.1:c.*374G>A, XM_011509207.1:c.*374G>A

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center