Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.
2.

rs7580332 [Homo sapiens]
    GAAGGTATGGTTGTCCTTGCTGTGG[A/G]AAGAAAGTTTAATCAGTCTTACTTG
    Chromosome:
    2:18359378
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3339/1672
    HGVS:
    NC_000002.11:g.18540644A>G, NC_000002.12:g.18359378A>G
    3.

    rs3825776 [Homo sapiens]
      GCCCCAACCCCACCTGTTGACTAGA[A/G]AATTGCCATGCACTGTGGTCACCAT
      Chromosome:
      15:58454631
      Gene:
      LIPC-AS1 (GeneView) LIPC (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4032/2019
      HGVS:
      NC_000015.10:g.58454631T>C, NC_000015.9:g.58746830T>C, NG_011465.1:g.27656T>C, NM_000236.2:c.88+22511T>C, NR_120338.1:n.209-17719A>G, XM_005254372.1:c.88+22511T>C, XM_005254373.1:c.88+22511T>C, XR_243158.1:n.209-17719A>G

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center