Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 175

1.

rs16851040 [Homo sapiens]
    ACCTAGCCCTTTACTTCACAGAATA[A/G]GCCCATAATGTGTGTGTTTTGCTTT
    Chromosome:
    3:141073523
    Gene:
    SPSB4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.1486/744
    HGVS:
    NC_000003.11:g.140792365A>G, NC_000003.12:g.141073523A>G, NM_080862.2:c.694+6725A>G, XM_017007509.1:c.694+6725A>G, XR_924215.2:n.1523+6725A>G, XR_924216.2:n.1523+6725A>G
    2.

    rs12523974 [Homo sapiens]
      TATTTCTAAGGTTGTTAGCAATGCT[A/G]TTCTGTAACCATTATGAAATCTCTC
      Chromosome:
      6:22073692
      Gene:
      CASC15 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2556/1280
      HGVS:
      NC_000006.11:g.22073921G>A, NC_000006.12:g.22073692G>A, NR_015410.1:n.1217+17002G>A
      3.

      rs11973337 [Homo sapiens]
        AAGAAACCAATGGCCTATAACTTCC[A/G]TGTCAAGATTGTCCATGGTCTATAA
        Chromosome:
        7:83662101
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1210/606
        HGVS:
        NC_000007.13:g.83291417A>G, NC_000007.14:g.83662101A>G
        4.

        rs10521829 [Homo sapiens]
          CTTTGCAGAATCATTAGGTTCCTGG[A/G]TCTGACCAACAAGTAGTGCCTGAAT
          Chromosome:
          X:142801592
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1073/405
          HGVS:
          NC_000023.10:g.141889378A>G, NC_000023.11:g.142801592A>G
          5.

          rs10521550 [Homo sapiens]
            AAGAGGAGTTAATTAGGTTGGCCAA[A/C]TGTTTTTATTTCTCAGCTGCATAAG
            Chromosome:
            X:112576919
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0077/29
            HGVS:
            NC_000023.10:g.111820147A>C, NC_000023.11:g.112576919A>C
            6.

            rs10521394 [Homo sapiens]
              CTAACATTGATTTTTGATGAATTCC[A/G]AAACTGTTTAATTTTCTAATGACAA
              Chromosome:
              X:80003601
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1499/566
              HGVS:
              NC_000023.10:g.79259100A>G, NT_187635.1:g.93482T>C
              7.

              rs10519186 [Homo sapiens]
                ATATTTTTCATGAGTAGGATTAACG[C/T]ATGTTTTCTTCCAACTTTTACCCAA
                Chromosome:
                15:62921658
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2680/1342
                HGVS:
                NC_000015.10:g.62921658C>T, NC_000015.9:g.63213857C>T
                9.

                rs10518048 [Homo sapiens]
                  GCCAGGGTGTAGTCCTCTGAGAAAG[A/G]AGTGATACATTTACATGTGAAAGCA
                  Chromosome:
                  16:72946841
                  Gene:
                  ZFHX3 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0248/124
                  HGVS:
                  NC_000016.10:g.72946841G>A, NC_000016.9:g.72980740G>A, NG_013211.1:g.116795C>T, NM_001164766.1:c.474+3628C>T, NM_006885.3:c.3216+3628C>T, XM_005255957.1:c.3216+3628C>T, XM_005255957.3:c.3216+3628C>T, XM_017023251.1:c.567+3628C>T
                  12.

                  rs10516147 [Homo sapiens]
                    CTTTTCTTGAGGCTGTTTTTAGTGA[A/G]TAAGTCTACCAGCTTCAGCAAAGCA
                    Chromosome:
                    5:178667483
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.2440/1222
                    HGVS:
                    NC_000005.10:g.178667483A>G, NC_000005.9:g.178094484A>G
                    13.

                    rs10515869 [Homo sapiens]
                      AAAGAGACTTCCTATTCACTTAGTT[C/T]GGTTCCCTTGTGACCTGAAGTCATT
                      Chromosome:
                      5:164085220
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.4405/2206
                      HGVS:
                      NC_000005.10:g.164085220G>A, NC_000005.9:g.163512226G>A
                      14.

                      rs10514691 [Homo sapiens]
                        ATTGGAGCATATTGAAGTTTCTCCA[C/T]GACAGAGTATCAGGATCCAAGTTCC
                        Chromosome:
                        3:36209948
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.0453/227
                        HGVS:
                        NC_000003.11:g.36251440C>T, NC_000003.12:g.36209948C>T
                        15.

                        rs10513475 [Homo sapiens]
                          TCTTACCATAGTGCTCATGTTCTTC[A/G]AGTCTGGTATCAGCAATCTCCTCTA
                          Chromosome:
                          3:155302521
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.0569/285
                          HGVS:
                          NC_000003.11:g.155020310G>A, NC_000003.12:g.155302521G>A
                          16.

                          rs10512574 [Homo sapiens]
                            TAGCTGGACAGCCAGTCCTTCCTTC[A/G]AGGGCCGTGTGGTTGTTGTAAGGCT
                            Chromosome:
                            17:70341823
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.1849/926
                            HGVS:
                            NC_000017.10:g.68337964T>C, NC_000017.11:g.70341823T>C, NW_003315954.1:g.35546T>C
                            17.

                            rs10511701 [Homo sapiens]
                              CTCAAAACAAAGGAAGTGCAATTTA[C/T]AGAAGGTAGTAGAATAGGCAGATAA
                              Chromosome:
                              9:22112600
                              Gene:
                              CDKN2B-AS1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.3712/1859
                              HGVS:
                              NC_000009.11:g.22112599T>C, NC_000009.12:g.22112600T>C, NR_003529.3:n.2774+205T>C, NR_047532.1:n.1563+205T>C, NR_047534.1:n.827+205T>C, NR_047535.1:n.856+205T>C, NR_047536.1:n.720+205T>C, NR_047537.1:n.781-7600T>C, NR_047538.1:n.645-7600T>C, NR_047543.1:n.856+205T>C, NR_120536.1:n.645-7904T>C
                              19.

                              rs10511630 [Homo sapiens]
                                GTGTCATGAAATATTATTGCAATTT[C/G]AGGCAGCTGTATGTAGTTCTGTGGG
                                Chromosome:
                                9:16962021
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.1138/570
                                HGVS:
                                NC_000009.11:g.16962019G>C, NC_000009.12:g.16962021G>C
                                20.

                                rs10511321 [Homo sapiens]
                                  TAAGTGGTTAAGTGTGGCCAGGTCA[C/T]TGTCTCCCAAGATTTGCTGGAGGAA
                                  Chromosome:
                                  3:113194658
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.0493/247
                                  HGVS:
                                  NC_000003.11:g.112913505T>C, NC_000003.12:g.113194658T>C

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center