Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 21

1.

rs28897670 [Homo sapiens]
    AATCCCTTCACCTGTTCCCTCCCCC[A/G]CTGCTGTGCTTTTTCTTTCCCTTGC
    Chromosome:
    3:12156160
    Gene:
    SYN2 (GeneView) TIMP4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0994/498
    HGVS:
    NC_000003.11:g.12197660A>G, NC_000003.12:g.12156160A>G, NG_011728.2:g.156773A>G, NM_003178.5:c.774+4834A>G, NM_003256.3:c.352+660T>C, NM_133625.4:c.774+4834A>G, XM_006713311.3:c.774+4834A>G, XM_006713312.3:c.291+4834A>G, XM_006713313.2:c.3+4834A>G, XR_001740240.1:n.960+4834A>G
    2.

    rs28897669 [Homo sapiens]
      CTGCTGTACCTCCATGCCTAGCAGC[A/G]GGCTAGACACACAGAGGGCAGGTGC
      Chromosome:
      3:12155799
      Gene:
      SYN2 (GeneView) TIMP4 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0994/498
      HGVS:
      NC_000003.11:g.12197299G>A, NC_000003.12:g.12155799G>A, NG_011728.2:g.156412G>A, NM_003178.5:c.774+4473G>A, NM_003256.3:c.352+1021C>T, NM_133625.4:c.774+4473G>A, XM_006713311.3:c.774+4473G>A, XM_006713312.3:c.291+4473G>A, XM_006713313.2:c.3+4473G>A, XR_001740240.1:n.960+4473G>A
      3.

      rs28897668 [Homo sapiens]
        GACTTGACCTCCCTGAAGGCAGGGA[A/T]CATGTTTCCTCATTTCCCCTGCTGT
        Chromosome:
        3:12155755
        Gene:
        SYN2 (GeneView) TIMP4 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.0240/120
        HGVS:
        NC_000003.11:g.12197255A>T, NC_000003.12:g.12155755A>T, NG_011728.2:g.156368A>T, NM_003178.5:c.774+4429A>T, NM_003256.3:c.352+1065T>A, NM_133625.4:c.774+4429A>T, XM_006713311.3:c.774+4429A>T, XM_006713312.3:c.291+4429A>T, XM_006713313.2:c.3+4429A>T, XR_001740240.1:n.960+4429A>T
        4.

        rs17035945 [Homo sapiens]
          GATGCTGTCAAACCACCTTCTGATA[C/T]TGTACATCGCAAGGATATACCATCT
          Chromosome:
          3:12153128
          Gene:
          SYN2 (GeneView) TIMP4 (GeneView)
          Functional Consequence:
          intron variant,utr variant 3 prime
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.1897/950
          HGVS:
          NC_000003.11:g.12194628C>T, NC_000003.12:g.12153128C>T, NG_011728.2:g.153741C>T, NM_003178.5:c.774+1802C>T, NM_003256.3:c.*387G>A, NM_133625.4:c.774+1802C>T, XM_006713311.3:c.774+1802C>T, XM_006713312.3:c.291+1802C>T, XM_006713313.2:c.3+1802C>T, XR_001740240.1:n.960+1802C>T
          5.

          rs3817004 [Homo sapiens]
            CCAGCCAAAGTGTAAGTACTTTGAG[A/G]TCAGGGCCTATAGACTGTATTGCTT
            Chromosome:
            3:12154174
            Gene:
            SYN2 (GeneView) TIMP4 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.1088/545
            HGVS:
            NC_000003.11:g.12195674A>G, NC_000003.12:g.12154174A>G, NG_011728.2:g.154787A>G, NM_003178.5:c.774+2848A>G, NM_003256.3:c.477+153T>C, NM_133625.4:c.774+2848A>G, XM_006713311.3:c.774+2848A>G, XM_006713312.3:c.291+2848A>G, XM_006713313.2:c.3+2848A>G, XR_001740240.1:n.960+2848A>G
            6.

            rs3755724 [Homo sapiens]
              GGGCTTCTTTCAGCTGCAGGAAGTG[C/T]TTTCAATGCCCTATTTATGAGGCTC
              Chromosome:
              3:12159406
              Gene:
              SYN2 (GeneView) TIMP4 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3876/1941
              HGVS:
              NC_000003.11:g.12200906C>T, NC_000003.12:g.12159406C>T, NG_011728.2:g.160019C>T, NM_003178.5:c.775-2140C>T, NM_003256.3:c.-566G>A, NM_133625.4:c.775-2140C>T, XM_006713311.3:c.775-2140C>T, XM_006713312.3:c.292-2140C>T, XM_006713313.2:c.4-2140C>T, XM_017007087.1:c.102+815C>T, XR_001740240.1:n.961-2140C>T
              7.

              rs2843586 [Homo sapiens]
                tgtctaagggccctagcagcaatgg[C/T]cctgttagcacaagaagcagataaa
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                A=0.4991/1884
                HGVS:
                NC_000023.10:g.114775033A>G, NR_110383.1:n.234-12928T>C, NR_110384.1:n.234-21014T>C, NW_004070891.1:g.1209499G, NW_004070891.1:g.1209499G>A, XR_245848.1:n.234-21014T>C
                8.

                rs931676 [Homo sapiens]
                  GCATCAACTCACTGGAATCCATTTA[C/T]AACTTCTGTGACAAGCCATGGGTGG
                  Chromosome:
                  3:12146943
                  Gene:
                  SYN2 (GeneView)
                  Functional Consequence:
                  intron variant,synonymous codon,upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency,by submitter
                  Global MAF:
                  C=0.0994/498
                  HGVS:
                  NC_000003.11:g.12188443T>C, NC_000003.12:g.12146943T>C, NG_011728.2:g.147556T>C, NM_003178.5:c.684+1108T>C, NM_133625.4:c.684+1108T>C, XM_006713311.3:c.684+1108T>C, XM_006713312.3:c.177T>C, XM_006713313.2:c.-1836T>C, XP_006713375.1:p.Tyr59, XR_001740240.1:n.870+1108T>C
                  9.

                  rs795011 [Homo sapiens]
                    CTTTGCCTCAGGTCTTTTCCCCAAG[A/C]TTTACCCGTGCCAGGGCTCAGTGAG
                    Chromosome:
                    3:12169546
                    Gene:
                    SYN2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    G=0.3826/1916
                    HGVS:
                    NC_000003.11:g.12211046G>T, NC_000003.12:g.12169546G>T, NG_011728.2:g.170159G>T, NM_003178.5:c.1159-211G>T, NM_133625.4:c.1159-211G>T, XM_006713311.3:c.1159-211G>T, XM_006713312.3:c.676-211G>T, XM_006713313.2:c.388-211G>T, XM_017007087.1:c.487-211G>T, XR_001740240.1:n.1513-211G>T
                    10.

                    rs795010 [Homo sapiens]
                      CTGATGATAGAGAAAGATGATAGAG[A/T]TAAAGACTGCACATAccataggtaa
                      Chromosome:
                      3:12167495
                      Gene:
                      SYN2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.2782/1393
                      HGVS:
                      NC_000003.11:g.12208995T>A, NC_000003.12:g.12167495T>A, NG_011728.2:g.168108T>A, NM_003178.5:c.1055+187T>A, NM_133625.4:c.1055+187T>A, XM_006713311.3:c.1055+187T>A, XM_006713312.3:c.572+187T>A, XM_006713313.2:c.284+187T>A, XM_017007087.1:c.383+187T>A, XR_001740240.1:n.1409+187T>A
                      11.

                      rs795009 [Homo sapiens]
                        GCCACACCAGCAAGAGGAGGGCATG[A/C]AACTTTCCAGAATTTTAGTTCACTG
                        Chromosome:
                        3:12167171
                        Gene:
                        SYN2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.2796/1400
                        HGVS:
                        NC_000003.11:g.12208671G>T, NC_000003.12:g.12167171G>T, NG_011728.2:g.167784G>T, NM_003178.5:c.981-63G>T, NM_133625.4:c.981-63G>T, XM_006713311.3:c.981-63G>T, XM_006713312.3:c.498-63G>T, XM_006713313.2:c.210-63G>T, XM_017007087.1:c.309-63G>T, XR_001740240.1:n.1335-63G>T
                        12.

                        rs794999 [Homo sapiens]
                          TCCTCAGCGGCCGGGCGGCCCCACC[A/G]CCCACGGAGATGCACCCTCCAGCAG
                          Chromosome:
                          3:12187515
                          Gene:
                          SYN2 (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.3111/1558
                          HGVS:
                          NC_000003.11:g.12229015A>G, NC_000003.12:g.12187515A>G, NG_011728.2:g.188128A>G, NM_133625.4:c.1516A>G, NP_598328.1:p.Thr506Ala, XM_006713312.3:c.1033A>G, XM_006713313.2:c.745A>G, XM_017007087.1:c.844A>G, XP_006713375.1:p.Thr345Ala, XP_006713376.1:p.Thr249Ala, XP_016862576.1:p.Thr282Ala
                          13.

                          rs598747 [Homo sapiens]
                            CTCCTCCGGGGCCACACGCAACTCA[C/T]TGTAGAAGGTGTGGTGCCAAATCTT
                            Chromosome:
                            3:12070510
                            Gene:
                            SYN2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.1787/895
                            HGVS:
                            NC_000003.11:g.12112010G>A, NC_000003.12:g.12070510G>A, NG_011728.2:g.71123G>A, NG_025675.2:g.456G>A, NM_003178.5:c.377+65582G>A, NM_133625.4:c.377+65582G>A, XM_006713311.3:c.377+65582G>A, XR_001740240.1:n.563+65582G>A
                            14.

                            rs598704 [Homo sapiens]
                              TGGCCTTGGGGTTCACAAGGGCCTC[C/T]GTCAGCAGCACCAGGTGCTCCTCCG
                              Chromosome:
                              3:12070553
                              Gene:
                              SYN2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              G=0.3888/1947
                              HGVS:
                              NC_000003.11:g.12112053G>A, NC_000003.12:g.12070553G>A, NG_011728.2:g.71166G>A, NG_025675.2:g.499G>A, NM_003178.5:c.377+65625G>A, NM_133625.4:c.377+65625G>A, XM_006713311.3:c.377+65625G>A, XR_001740240.1:n.563+65625G>A
                              15.

                              rs308969 [Homo sapiens]
                                GATCCTTATGCAAATTCCAGTCATC[C/T]TGGGAGGATTTATACTCTAGGCTCT
                                Chromosome:
                                3:12135583
                                Gene:
                                SYN2 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.0397/199
                                HGVS:
                                NC_000003.11:g.12177083C>T, NC_000003.12:g.12135583C>T, NG_011728.2:g.136196C>T, NM_003178.5:c.378-5068C>T, NM_133625.4:c.378-5068C>T, XM_006713311.3:c.378-5068C>T, XR_001740240.1:n.564-5068C>T
                                16.

                                rs308965 [Homo sapiens]
                                  TTCACAGACTGAGAGCTCACTTAGA[C/G]ATAACTGGATTCCTTATAGGATTAT
                                  Chromosome:
                                  3:12142241
                                  Gene:
                                  SYN2 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.0429/215
                                  HGVS:
                                  NC_000003.11:g.12183741C>G, NC_000003.12:g.12142241C>G, NG_011728.2:g.142854C>G, NM_003178.5:c.527+245C>G, NM_133625.4:c.527+245C>G, XM_006713311.3:c.527+245C>G, XR_001740240.1:n.713+245C>G
                                  17.

                                  rs308964 [Homo sapiens]
                                    GGGAAAGCAGAACTAAAAACTAGTT[A/G]CCTAAATTTAGACCTAGTGCTTTTA
                                    Chromosome:
                                    3:12141511
                                    Gene:
                                    SYN2 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.0397/199
                                    HGVS:
                                    NC_000003.11:g.12183011A>G, NC_000003.12:g.12141511A>G, NG_011728.2:g.142124A>G, NM_003178.5:c.436-394A>G, NM_133625.4:c.436-394A>G, XM_006713311.3:c.436-394A>G, XR_001740240.1:n.622-394A>G
                                    18.

                                    rs308953 [Homo sapiens]
                                      TATAAGATTTTTGGCAACTTGAGTC[A/G]AAGTCTCCTCTCTAAAACTGCTCCT
                                      Chromosome:
                                      3:12156497
                                      Gene:
                                      SYN2 (GeneView) TIMP4 (GeneView)
                                      Functional Consequence:
                                      intron variant,upstream variant 2KB
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.0385/193
                                      HGVS:
                                      NC_000003.11:g.12197997C>T, NC_000003.12:g.12156497C>T, NG_011728.2:g.157110C>T, NM_003178.5:c.775-5049C>T, NM_003256.3:c.352+323G>A, NM_133625.4:c.775-5049C>T, XM_006713311.3:c.775-5049C>T, XM_006713312.3:c.292-5049C>T, XM_006713313.2:c.4-5049C>T, XM_017007087.1:c.-1993C>T, XR_001740240.1:n.961-5049C>T
                                      19.

                                      rs308952 [Homo sapiens]
                                        AGGGTAGCTGTGTTACAGTTATCTC[A/G]GTCTGCCTCCTGTGATGGCCACCTT
                                        Chromosome:
                                        3:12154122
                                        Gene:
                                        SYN2 (GeneView) TIMP4 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        A=0.1845/924
                                        HGVS:
                                        NC_000003.11:g.12195622A>G, NC_000003.12:g.12154122A>G, NG_011728.2:g.154735A>G, NM_003178.5:c.774+2796A>G, NM_003256.3:c.477+205T>C, NM_133625.4:c.774+2796A>G, XM_006713311.3:c.774+2796A>G, XM_006713312.3:c.291+2796A>G, XM_006713313.2:c.3+2796A>G, XR_001740240.1:n.960+2796A>G
                                        20.

                                        rs308950 [Homo sapiens]
                                          CTTGTAGCACTGCCACTAATATGCT[C/G]TGTGACCCTGGGAACTCACTGTCAT
                                          Chromosome:
                                          3:12161366
                                          Gene:
                                          SYN2 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                          Global MAF:
                                          C=0.1867/935
                                          HGVS:
                                          NC_000003.11:g.12202866C>G, NC_000003.12:g.12161366C>G, NG_011728.2:g.161979C>G, NM_003178.5:c.775-180C>G, NM_133625.4:c.775-180C>G, XM_006713311.3:c.775-180C>G, XM_006713312.3:c.292-180C>G, XM_006713313.2:c.4-180C>G, XM_017007087.1:c.103-180C>G, XR_001740240.1:n.961-180C>G

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center