Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

6.

rs2298771 [Homo sapiens]
    AGACAGTTGTATGTCCAATCATACA[A/G]CAGAAATTGGGAAAGATCTTGACTA
    Chromosome:
    2:166036278
    Gene:
    LOC102724058 (GeneView) SCN1A (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.2115/1059
    HGVS:
    AB093548.1:c.3199A, AB093548.1:c.3199A>G, BAC21101.1:p.Thr1067, BAC21101.1:p.Thr1067Ala, NC_000002.11:g.166892788C>T, NC_000002.12:g.166036278C>T, NG_011906.1:g.42362G>A, NM_001165963.1:c.3199G>A, NM_001165964.1:c.3115G>A, NM_001202435.1:c.3199G>A, NM_006920.4:c.3166G>A, NP_001159435.1:p.Ala1067Thr, NP_001159436.1:p.Ala1039Thr, NP_001189364.1:p.Ala1067Thr, NP_008851.3:p.Ala1056Thr, NR_110598.1:n.618C>T, XM_011511602.2:c.3199G>A, XM_011511604.2:c.3166G>A, XM_011511605.2:c.3163G>A, XM_011511606.2:c.3115G>A, XM_017004644.1:c.3199G>A, XM_017004645.1:c.3166G>A, XM_017004646.1:c.3166G>A, XM_017004647.1:c.3166G>A, XM_017004648.1:c.3166G>A, XM_017004649.1:c.3166G>A, XM_017004650.1:c.3163G>A, XM_017004651.1:c.3115G>A, XM_017004652.1:c.3115G>A, XM_017004653.1:c.3112G>A, XM_017004654.1:c.757G>A, XP_011509904.1:p.Ala1067Thr, XP_011509906.1:p.Ala1056Thr, XP_011509907.1:p.Ala1055Thr, XP_011509908.1:p.Ala1039Thr, XP_016860133.1:p.Ala1067Thr, XP_016860134.1:p.Ala1056Thr, XP_016860135.1:p.Ala1056Thr, XP_016860136.1:p.Ala1056Thr, XP_016860137.1:p.Ala1056Thr, XP_016860138.1:p.Ala1056Thr, XP_016860139.1:p.Ala1055Thr, XP_016860140.1:p.Ala1039Thr, XP_016860141.1:p.Ala1039Thr, XP_016860142.1:p.Ala1038Thr, XP_016860143.1:p.Ala253Thr, XR_001738883.1:n.3585G>A, XR_001738884.1:n.3557G>A, XR_001738885.1:n.3549G>A
    7.

    rs2126152 [Homo sapiens]
      CAAATCTTATGTCATGTATGTTATT[A/C/T]TCTGGTGGAATTAGATTAATTTTGT
      Chromosome:
      2:166039633
      Gene:
      SCN1A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      T=0.2107/1055
      HGVS:
      AB093548.1:c.2416-37A>C, AB093548.1:c.2416-37A>T, NC_000002.11:g.166896143T>A, NC_000002.11:g.166896143T>G, NC_000002.12:g.166039633T>A, NC_000002.12:g.166039633T>G, NG_011906.1:g.39007A>C, NG_011906.1:g.39007A>T, NM_001165963.1:c.2416-37A>C, NM_001165963.1:c.2416-37A>T, NM_001165964.1:c.2332-37A>C, NM_001165964.1:c.2332-37A>T, NM_001202435.1:c.2416-37A>C, NM_001202435.1:c.2416-37A>T, NM_006920.4:c.2383-37A>C, NM_006920.4:c.2383-37A>T, XM_011511602.2:c.2416-37A>C, XM_011511602.2:c.2416-37A>T, XM_011511604.2:c.2383-37A>C, XM_011511604.2:c.2383-37A>T, XM_011511605.2:c.2380-37A>C, XM_011511605.2:c.2380-37A>T, XM_011511606.2:c.2332-37A>C, XM_011511606.2:c.2332-37A>T, XM_017004644.1:c.2416-37A>C, XM_017004644.1:c.2416-37A>T, XM_017004645.1:c.2383-37A>C, XM_017004645.1:c.2383-37A>T, XM_017004646.1:c.2383-37A>C, XM_017004646.1:c.2383-37A>T, XM_017004647.1:c.2383-37A>C, XM_017004647.1:c.2383-37A>T, XM_017004648.1:c.2383-37A>C, XM_017004648.1:c.2383-37A>T, XM_017004649.1:c.2383-37A>C, XM_017004649.1:c.2383-37A>T, XM_017004650.1:c.2380-37A>C, XM_017004650.1:c.2380-37A>T, XM_017004651.1:c.2332-37A>C, XM_017004651.1:c.2332-37A>T, XM_017004652.1:c.2332-37A>C, XM_017004652.1:c.2332-37A>T, XM_017004653.1:c.2329-37A>C, XM_017004653.1:c.2329-37A>T, XM_017004654.1:c.-27-37A>C, XM_017004654.1:c.-27-37A>T, XR_001738883.1:n.2802-37A>C, XR_001738883.1:n.2802-37A>T, XR_001738884.1:n.2774-37A>C, XR_001738884.1:n.2774-37A>T, XR_001738885.1:n.2766-37A>C, XR_001738885.1:n.2766-37A>T

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center