Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs12593813 [Homo sapiens]
    CCAGACAAGAGCTGCAGGGCAAGCC[A/G]TAATTTCAGAGAGTAAAAGAGAAAA
    Chromosome:
    15:67744514
    Gene:
    MAP2K5 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4271/2139
    HGVS:
    NC_000015.10:g.67744514A>G, NC_000015.9:g.68036852A>G, NG_029143.1:g.206832A>G, NM_001206804.1:c.967-3717A>G, NM_002757.3:c.1045-3717A>G, NM_145160.2:c.1075-3717A>G, XM_005254542.1:c.1045-3717A>G, XM_005254543.1:c.667-3717A>G, XM_005254544.1:c.595-3717A>G, XM_005254545.1:c.505-3717A>G, XM_011521784.1:c.1075-3717A>G, XM_011521785.1:c.1075-3717A>G, XM_011521786.1:c.1075-4055A>G
    2.
    3.

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center