Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

1.

rs2069861 [Homo sapiens]
    TGTGTCACGTGAAGCTTAATATAAA[C/T]AAGTTTCTTGTCACTGCCACCACCA
    Chromosome:
    7:22732035
    Gene:
    IL6 (GeneView)
    Functional Consequence:
    downstream variant 500B
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0222/111
    HGVS:
    NC_000007.13:g.22771654C>T, NC_000007.14:g.22732035C>T, NG_011640.1:g.9889C>T, NM_000600.4:c.*462C>T, NM_001318095.1:c.*462C>T, XM_005249746.1:c.*462C>T, XM_011515390.2:c.*462C>T
    2.

    rs2069827 [Homo sapiens]
      GCCCAACAGAGGTCACTGTTTTATC[G/T]ATCTTGAAGAGATCTCTTCTTAGCA
      Chromosome:
      7:22725837
      Gene:
      IL6 (GeneView) LOC541472 (GeneView)
      Functional Consequence:
      nc transcript variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0365/183
      HGVS:
      NC_000007.13:g.22765456G>T, NC_000007.14:g.22725837G>T, NG_011640.1:g.3691G>T, NM_000600.4:c.-1426G>T, NM_001318095.1:c.-1463G>T, NR_131935.1:n.922C>A, XM_005249745.1:c.-1426G>T, XM_005249745.4:c.-1426G>T, XM_005249746.1:c.-1463G>T, XM_011515390.2:c.-506G>T
      3.

      rs1818879 [Homo sapiens]
        AGACGAGCTGGGCGCAGTGGCTCAC[A/G]CCTATAATCCCAGCACTTTGGGAGG
        Chromosome:
        7:22733108
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        A=0.4267/2137
        HGVS:
        NC_000007.13:g.22772727G>A, NC_000007.14:g.22733108G>A, NG_011640.1:g.10962G>A
        4.

        rs1800797 [Homo sapiens]
          TGAAGTAACTGCACGAAATTTGAGG[A/G]TGGCCAGGCAGTTCTACAACAGCCG
          Chromosome:
          7:22726602
          Gene:
          IL6 (GeneView) LOC541472 (GeneView)
          Functional Consequence:
          intron variant,nc transcript variant,upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.1382/692
          HGVS:
          NC_000007.13:g.22766221A>G, NC_000007.14:g.22726602A>G, NG_011640.1:g.4456A>G, NM_000600.4:c.-661A>G, NM_001318095.1:c.-698A>G, NR_131935.1:n.157T>C, XM_005249745.1:c.-661A>G, XM_005249745.4:c.-661A>G, XM_005249746.1:c.-698A>G, XM_011515390.2:c.-85+344A>G
          5.

          rs1800795 [Homo sapiens]
            ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA
            Chromosome:
            7:22727026
            Gene:
            IL6 (GeneView) LOC541472 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.1412/707
            HGVS:
            NC_000007.13:g.22766645C>G, NC_000007.14:g.22727026C>G, NG_011640.1:g.4880C>G, NM_000600.4:c.-237C>G, NM_001318095.1:c.-274C>G, NR_131935.1:n.54-321G>C, XM_005249745.1:c.-237C>G, XM_005249745.4:c.-237C>G, XM_005249746.1:c.-274C>G, XM_011515390.2:c.-84-153C>G
            6.

            rs1554606 [Homo sapiens]
              TTAGTTCATCCTGGGAAAGGTACTC[G/T]CAGGGCCTTTTCCCTCTCTGGCTGC
              Chromosome:
              7:22729088
              Gene:
              IL6 (GeneView) LOC541472 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2494/1249
              HGVS:
              NC_000007.13:g.22768707T>G, NC_000007.14:g.22729088T>G, NG_011640.1:g.6942T>G, NM_000600.4:c.324+282T>G, NM_001318095.1:c.96+282T>G, NR_131935.1:n.-1468A>C, XM_005249745.1:c.486+282T>G, XM_005249745.4:c.486+282T>G, XM_005249746.1:c.96+282T>G, XM_011515390.2:c.324+282T>G

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center