Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs6994992 [Homo sapiens]
    AAGCACCATGCAGGGTTCAAGTGAA[C/T]GTATACTGGAGGCCAGACCTGCCCA
    Chromosome:
    8:31638065
    Gene:
    NRG1 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.4421/2214
    HGVS:
    NC_000008.10:g.31495581C>T, NC_000008.11:g.31638065C>T, NG_012005.1:g.3314C>T, NM_001159995.2:c.-1330C>T, NM_001159999.2:c.-1330C>T, NM_001160001.2:c.-1330C>T, NM_001322201.1:c.-1922C>T, NM_001322202.1:c.-1871C>T, NM_001322203.1:c.-1330C>T, NM_013962.2:c.-1920C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center