Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 28

3.

rs17271951 [Homo sapiens]
    GTTCCTAGTTGAGCAACAATTTCTG[C/T]GTTGGGAGAGGATAACAAAGCCAAG
    Chromosome:
    16:52504128
    Gene:
    TOX3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1789/896
    HGVS:
    NC_000016.10:g.52504128T>C, NC_000016.9:g.52538040T>C, NG_012623.1:g.48675A>G, NM_001080430.3:c.88-35554A>G, NM_001146188.2:c.75+15278A>G, XM_005255892.1:c.88-35554A>G, XM_005255892.3:c.88-35554A>G, XM_005255893.1:c.75+15278A>G, XM_017023142.1:c.75+15278A>G
    4.

    rs16901979 [Homo sapiens]
      GTGTTAATGATTTAGCATTACTTAT[A/C]TCTGGCAAATGGTATTTTTGAGATA
      Chromosome:
      8:127112671
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2119/1061
      HGVS:
      NC_000008.10:g.128124916C>A, NC_000008.11:g.127112671C>A
      5.

      rs13281615 [Homo sapiens]
        GTAACTATGAATCTCATCAAAAGAA[A/G]GCAGAACGCAGATATTCTGAGTAGG
        Chromosome:
        8:127343372
        Gene:
        CASC21 (GeneView) CASC8 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4912/2460
        HGVS:
        NC_000008.10:g.128355618A>G, NC_000008.11:g.127343372A>G, NR_117099.1:n.457+3937A>G, NR_117099.1:n.457+3938A>G, NR_117100.1:n.1177-53312T>C, NR_117100.1:n.1177-53313T>C
        6.

        rs12443621 [Homo sapiens]
          CGTTTTATATGCATTAGGCCTGGCA[A/G]TGAACTTGAGGTAGGTATTACTATC
          Chromosome:
          16:52514125
          Gene:
          TOX3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.4906/2457
          HGVS:
          NC_000016.10:g.52514125A>G, NC_000016.9:g.52548037A>G, NG_012623.1:g.38678T>C, NM_001080430.3:c.87+32512T>C, NM_001146188.2:c.75+5281T>C, XM_005255892.1:c.87+32512T>C, XM_005255892.3:c.87+32512T>C, XM_005255893.1:c.75+5281T>C, XM_017023142.1:c.75+5281T>C
          10.

          rs8051542 [Homo sapiens]
            TTTAAACATTTAGGTTATTAGAGGA[C/T]GCAGCACTATGATTGGAGCAAAAAC
            Chromosome:
            16:52500255
            Gene:
            TOX3 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3133/1569
            HGVS:
            NC_000016.10:g.52500255T>C, NC_000016.9:g.52534167T>C, NG_012623.1:g.52548A>G, NM_001080430.3:c.88-31681A>G, NM_001146188.2:c.75+19151A>G, XM_005255892.1:c.88-31681A>G, XM_005255892.3:c.88-31681A>G, XM_005255893.1:c.75+19151A>G, XM_017023142.1:c.75+19151A>G
            12.

            rs6983267 [Homo sapiens]
              GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
              Chromosome:
              8:127401060
              Gene:
              CASC8 (GeneView) CCAT2 (GeneView)
              Functional Consequence:
              intron variant,nc transcript variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3902/1954
              HGVS:
              NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A
              13.

              rs4784227 [Homo sapiens]
                AAAAGTCCCAATTTGTAGTGTTTGC[C/T]GATTATTGTGATGTAAATACTCCCA
                Chromosome:
                16:52565276
                Gene:
                CASC16 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2001/1002
                HGVS:
                NC_000016.10:g.52565276C>T, NC_000016.9:g.52599188C>T, NR_033920.1:n.605-2414G>A, XR_243421.1:n.38-2414G>A
                15.

                rs4666451 [Homo sapiens]
                  tttggatagctgcataatgttctat[A/G]tgatggatattacatgattcttgaa
                  Chromosome:
                  2:19087182
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.2376/1190
                  HGVS:
                  NC_000002.11:g.19286943G>A, NC_000002.12:g.19087182G>A
                  16.
                  17.

                  rs3803662 [Homo sapiens]
                    TCTCCTTAATGCCTCTATAGCTGTC[C/T]CTTAGCGAAGAATAAAACTGTGGAC
                    Chromosome:
                    16:52552429
                    Gene:
                    CASC16 (GeneView)
                    Functional Consequence:
                    nc transcript variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4403/2205
                    HGVS:
                    NC_000016.10:g.52552429A>G, NC_000016.9:g.52586341A>G, NG_012623.1:g.374T>C, NR_033920.1:n.659T>C, XR_243421.1:n.92T>C
                    18.

                    rs3095604 [Homo sapiens]
                      TGGCCTTCAGCCTTGGCGAAGGGAA[C/G]GGGCTTTATACTAAATGGGAACGTT
                      Chromosome:
                      16:52548067
                      Gene:
                      TOX3 (GeneView)
                      Functional Consequence:
                      upstream variant 2KB
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.4403/2205
                      HGVS:
                      NC_000016.10:g.52548067G>C, NC_000016.9:g.52581979G>C, NG_012623.1:g.4736C>G, NM_001080430.3:c.-1344C>G, NM_001146188.2:c.-453C>G, XM_005255892.1:c.-1344C>G, XM_005255892.3:c.-1344C>G
                      20.

                      rs2981578 [Homo sapiens]
                        AGCTTTTACCTCTATGCAAATATGC[A/G/T]GTTTGGAGCAGGGAAGAAAGGTTAA
                        Chromosome:
                        10:121580797
                        Gene:
                        FGFR2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.3720/1863
                        HGVS:
                        NC_000010.10:g.123340311C>T, NC_000010.11:g.121580797C>A, NC_000010.11:g.121580797C>T, NG_012449.2:g.22662G>A, NG_012449.2:g.22662G>T, NM_000141.4:c.109+12912G>A, NM_000141.4:c.109+12912G>T, NM_001144913.1:c.109+12912G>A, NM_001144913.1:c.109+12912G>T, NM_001144914.1:c.109+12912G>A, NM_001144914.1:c.109+12912G>T, NM_001144915.1:c.109+12912G>A, NM_001144915.1:c.109+12912G>T, NM_001144916.1:c.109+12912G>A, NM_001144916.1:c.109+12912G>T, NM_001144917.1:c.109+12912G>A, NM_001144917.1:c.109+12912G>T, NM_001144918.1:c.109+12912G>A, NM_001144918.1:c.109+12912G>T, NM_001144919.1:c.109+12912G>A, NM_001144919.1:c.109+12912G>T, NM_001320658.1:c.109+12912G>A, NM_001320658.1:c.109+12912G>T, NM_022970.3:c.109+12912G>A, NM_022970.3:c.109+12912G>T, NM_023029.2:c.109+12912G>A, NM_023029.2:c.109+12912G>T, NR_073009.1:n.756+12912G>A, NR_073009.1:n.756+12912G>T, XM_006717708.2:c.166+12912G>A, XM_006717708.2:c.166+12912G>T, XM_006717710.3:c.166+12912G>A, XM_006717710.3:c.166+12912G>T, XM_006717711.2:c.166+12912G>A, XM_006717711.2:c.166+12912G>T, XM_006717712.2:c.166+12912G>A, XM_006717712.2:c.166+12912G>T, XM_017015920.1:c.166+12912G>A, XM_017015920.1:c.166+12912G>T, XM_017015921.1:c.166+12912G>A, XM_017015921.1:c.166+12912G>T, XM_017015922.1:c.166+12912G>A, XM_017015922.1:c.166+12912G>T, XM_017015923.1:c.166+12912G>A, XM_017015923.1:c.166+12912G>T, XM_017015924.1:c.166+12912G>A, XM_017015924.1:c.166+12912G>T, XM_017015925.1:c.166+12912G>A, XM_017015925.1:c.166+12912G>T

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center