Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs193922702 [Homo sapiens]
    ACCCCCATACCACGGCGGCACACCC[A/G]GAGCGCCGAGGACGACTCGGAGCGG
    Chromosome:
    12:4370563
    Gene:
    FGF23 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000012.11:g.4479729C>T, NC_000012.12:g.4370563C>T, NG_007087.1:g.14166G>A, NM_020638.2:c.536G>A, NP_065689.1:p.Arg179Gln

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center