Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs1447295 [Homo sapiens]
    AGTGCCATTGGGGAGGTATGTAAAA[A/C]GTGCTATGGAAAAAAAGCAACAGGA
    Chromosome:
    8:127472793
    Gene:
    CASC8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1811/907
    HGVS:
    NC_000008.10:g.128485038A>C, NC_000008.11:g.127472793A>C, NR_024393.1:n.1041+6290T>G, NR_117100.1:n.1041+6290T>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center