Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 22

1.

rs7694646 [Homo sapiens]
    CTGTAGAAGTAGCTATTATTCTGAA[A/T]TTGGCATTTATTATTTCAGTGATTT
    Chromosome:
    4:99138581
    Gene:
    ADH4 (GeneView) LOC100507053 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1170/586
    HGVS:
    NC_000004.11:g.100059732T>A, NC_000004.12:g.99138581T>A, NM_000670.4:c.350+480A>T, NM_001306171.1:c.407+480A>T, NM_001306172.1:c.407+480A>T, NR_037884.1:n.679+4776T>A, XM_017007713.1:c.407+480A>T, XM_017007714.1:c.407+480A>T, XM_017007715.1:c.350+480A>T
    2.

    rs6837311 [Homo sapiens]
      ATTAACTCCCTTCAACTGTGTTTAT[A/T]TTTTCAAGTACATTTCACAAATTTG
      Chromosome:
      4:99274116
      Gene:
      LOC100507053 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1603/803
      HGVS:
      NC_000004.11:g.100195273T>A, NC_000004.12:g.99274116T>A, NR_037884.1:n.3790-12679T>A, XR_244675.1:n.691-9T>A
      3.

      rs2814778 [Homo sapiens]
        GGCTRTCAGCGCCTGTGCTTCCAAG[A/G]TAAGAGCCAAGGACTAATGAGGGCC
        Chromosome:
        1:159204893
        Gene:
        ACKR1 (GeneView)
        Functional Consequence:
        upstream variant 2KB,utr variant 5 prime
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2664/1334
        HGVS:
        NC_000001.10:g.159174683T>C, NC_000001.11:g.159204893T>C, NG_011626.2:g.5174T>C, NG_051933.1:g.38330T>C, NM_001122951.2:c.-541T>C, NM_002036.3:c.-67T>C
        4.

        rs2066702 [Homo sapiens]
          GTCTCTTCTTTCCTATTGCAGTATC[C/T]GTACCGTCCTGACGTTTTGAGGCAA
          Chromosome:
          4:99307860
          Gene:
          ADH1B (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.0531/266
          HGVS:
          NC_000004.11:g.100229017G>A, NC_000004.12:g.99307860G>A, NG_011435.1:g.18556C>T, NM_000668.5:c.1108C>T, NM_001286650.1:c.988C>T, NP_000659.2:p.Arg370Cys, NP_001273579.1:p.Arg330Cys, XM_005262730.1:c.988C>T, XP_005262787.1:p.Arg330Cys
          5.

          rs2066701 [Homo sapiens]
            AAACTTTACCTATAAAATGTTAATG[C/T]ACCAACAATTTTTCTTGATCATGTG
            Chromosome:
            4:99317256
            Gene:
            ADH1B (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.3672/1839
            HGVS:
            NC_000004.11:g.100238413G>A, NC_000004.12:g.99317256G>A, NG_011435.1:g.9160C>T, NM_000668.5:c.259+790C>T, NM_001286650.1:c.139+790C>T, XM_005262730.1:c.139+790C>T
            6.

            rs1984362 [Homo sapiens]
              CATGAAAAGTGAAAGTAGTGAAGCG[C/T]TTGCCCAGCCATACAAGGCCAGCAT
              Chromosome:
              4:99149816
              Gene:
              LOC100507053 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              A=0.1122/562
              HGVS:
              NC_000004.11:g.100070973G>A, NC_000004.12:g.99149816G>A, NR_037884.1:n.680-4729G>A
              7.

              rs1800759 [Homo sapiens]
                AATTACAGCAACAAAGGAGAAAAGG[A/C]AGTGATTGGAGAATTAAGCAACATG
                Chromosome:
                4:99144358
                Gene:
                ADH4 (GeneView) LOC100507053 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.4379/2193
                HGVS:
                NC_000004.11:g.100065509T>G, NC_000004.12:g.99144358T>G, NM_000670.4:c.-136A>C, NM_001306171.1:c.-227A>C, NM_001306172.1:c.-219A>C, NR_037884.1:n.680-10187T>G, NR_037884.1:n.680-10193T>G, XM_017007713.1:c.-219A>C, XM_017007714.1:c.-227A>C, XM_017007715.1:c.-136A>C
                8.

                rs1693482 [Homo sapiens]
                  CACGGATCATACCATGGTGTCAAGC[C/T]GACCGATGACTTCAAACGAAAAATC
                  Chromosome:
                  4:99342808
                  Gene:
                  ADH1C (GeneView)
                  Functional Consequence:
                  intron variant,missense
                  Allele Origin:
                  T(germline)/C(germline)
                  Clinical significance:
                  other
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2143/1073
                  HGVS:
                  NC_000004.11:g.100263965C>T, NC_000004.12:g.99342808C>T, NG_011718.1:g.14953G>A, NM_000669.4:c.815G>A, NP_000660.1:p.Arg272Gln, NR_133005.1:n.1154+31G>A, XM_011531588.2:c.713G>A, XM_011531589.1:c.695G>A, XP_011529890.1:p.Arg238Gln, XP_011529891.1:p.Arg232Gln
                  9.

                  rs1693427 [Homo sapiens]
                    AGTTGAAAGTAGCCTATTTTAGTCC[C/T]AGTAGATGTTGGGAAGATCTGGTAT
                    Chromosome:
                    4:99345670
                    Gene:
                    ADH1C (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    C=0.2145/1074
                    HGVS:
                    NC_000004.11:g.100266827T>C, NC_000004.12:g.99345670T>C, NG_011718.1:g.12091A>G, NM_000669.4:c.260-404A>G, NR_133005.1:n.630-404A>G, XM_011531588.2:c.158-404A>G, XM_011531589.1:c.140-404A>G
                    10.

                    rs1573496 [Homo sapiens]
                      TATACCTGGTTTCACTGTAGTCACT[C/G]CTTCTCCAATGCTCTCTACAATCCC
                      Chromosome:
                      4:99428512
                      Gene:
                      ADH7 (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.0380/190
                      HGVS:
                      NC_000004.11:g.100349669C>G, NC_000004.12:g.99428512C>G, NM_000673.4:c.275G>C, NM_001166504.1:c.299G>C, NP_000664.2:p.Gly92Ala, NP_001159976.1:p.Gly100Ala
                      11.
                      12.

                      rs1229966 [Homo sapiens]
                        TGTCCTTTATGTTGACATGTTCATG[C/T]TGACAGACTGCATCTGATTAAACAG
                        Chromosome:
                        4:99292276
                        Gene:
                        ADH1A (GeneView) LOC100507053 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.4291/2149
                        HGVS:
                        NC_000004.11:g.100213433A>G, NC_000004.12:g.99292276A>G, NM_000667.3:c.-1362T>C, NR_037884.1:n.4160+1328A>G, XR_001741125.1:n.-1288T>C
                        13.

                        rs1154470 [Homo sapiens]
                          CTAAGTATCAGCCTCACATCATTAG[A/G]TCATGATGAGGAGGGGACAGAAATG
                          Chromosome:
                          4:99435180
                          Gene:
                          ADH7 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.2420/1212
                          HGVS:
                          NC_000004.11:g.100356337G>A, NC_000004.12:g.99435180G>A, NM_000673.4:c.54+36C>T, NM_001166504.1:c.-76C>T
                          14.

                          rs1154400 [Homo sapiens]
                            GCGGTGCTCGAGCTGTGGTGCGTGC[C/T]GCTAAGTTGTGCGTTCCAGGGTGCA
                            Chromosome:
                            4:99088859
                            Gene:
                            ADH5 (GeneView) LOC100507053 (GeneView)
                            Functional Consequence:
                            nc transcript variant,upstream variant 2KB
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            C=0.1913/958
                            HGVS:
                            NC_000004.11:g.100010010C>T, NC_000004.12:g.99088859C>T, NM_000671.4:c.-159G>A, NR_037884.1:n.3C>T
                            15.

                            rs1126671 [Homo sapiens]
                              AGCTGCTGGTAGCAAAGGATTGACT[A/G]TTTTTCCAGAGGAGCTAATAATCGG
                              Chromosome:
                              4:99127263
                              Gene:
                              ADH4 (GeneView) LOC100507053 (GeneView)
                              Functional Consequence:
                              intron variant,missense
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              T=0.1530/766
                              HGVS:
                              NC_000004.11:g.100048414T>C, NC_000004.12:g.99127263T>C, NM_000670.4:c.925A>G, NM_001306171.1:c.982A>G, NM_001306172.1:c.982A>G, NP_000661.2:p.Ile309Val, NP_001293100.1:p.Ile328Val, NP_001293101.1:p.Ile328Val, NR_037884.1:n.429-6292T>C, XM_017007713.1:c.982A>G, XM_017007714.1:c.982A>G, XM_017007715.1:c.925A>G, XP_016863202.1:p.Ile328Val, XP_016863203.1:p.Ile328Val, XP_016863204.1:p.Ile309Val
                              16.

                              rs1126670 [Homo sapiens]
                                TCAATCCTAGAGACTTACATAAACC[G/T]ATCCAGGAAGTTATCATTGAATTGA
                                Chromosome:
                                4:99131582
                                Gene:
                                ADH4 (GeneView) LOC100507053 (GeneView)
                                Functional Consequence:
                                intron variant,synonymous codon
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.1528/765
                                HGVS:
                                NC_000004.11:g.100052733C>A, NC_000004.12:g.99131582C>A, NM_000670.4:c.765G>T, NM_001306171.1:c.822G>T, NM_001306172.1:c.822G>T, NP_000661.2:p.Pro255, NP_001293100.1:p.Pro274, NP_001293101.1:p.Pro274, NR_037884.1:n.429-1973C>A, XM_017007713.1:c.822G>T, XM_017007714.1:c.822G>T, XM_017007715.1:c.765G>T, XP_016863202.1:p.Pro274, XP_016863203.1:p.Pro274, XP_016863204.1:p.Pro255
                                17.

                                rs1042364 [Homo sapiens]
                                  CTTTTGAAGATGCCAGGAGCAATTC[A/G]GAATACTATCTGATTGAATGTGAAC
                                  Chromosome:
                                  4:99124423
                                  Gene:
                                  ADH4 (GeneView) LOC100507053 (GeneView)
                                  Functional Consequence:
                                  downstream variant 500B,intron variant,utr variant 3 prime
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  T=0.1172/587
                                  HGVS:
                                  NC_000004.11:g.100045574T>C, NC_000004.12:g.99124423T>C, NM_000670.4:c.*19A>G, NM_001306171.1:c.*19A>G, NM_001306172.1:c.*19A>G, NR_037884.1:n.429-9132T>C, XM_017007713.1:c.*334A>G, XM_017007714.1:c.*334A>G, XM_017007715.1:c.*334A>G
                                  18.

                                  rs1042026 [Homo sapiens]
                                    TCACATTTACAAGTAGTGAAGGTCC[A/G]AGAGTTCTAAATACAGGAAATTTCT
                                    Chromosome:
                                    4:99307309
                                    Gene:
                                    ADH1B (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    C=0.3670/1838
                                    HGVS:
                                    NC_000004.11:g.100228466T>C, NC_000004.12:g.99307309T>C, NG_011435.1:g.19107A>G, NM_000668.5:c.*531A>G, NM_001286650.1:c.*531A>G, XM_005262730.1:c.*531A>G
                                    19.

                                    rs975833 [Homo sapiens]
                                      ATATTAAGTCCAGTTCCTTATATAA[C/G]CATACAATTTCATCATCACATAATT
                                      Chromosome:
                                      4:99280582
                                      Gene:
                                      ADH1A (GeneView) LOC100507053 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      C=0.4002/2004
                                      HGVS:
                                      NC_000004.11:g.100201739G>C, NC_000004.12:g.99280582G>C, NM_000667.3:c.829-303C>G, NR_037884.1:n.3790-6213G>C, XR_001741125.1:n.903-1018C>G
                                      20.

                                      rs971074 [Homo sapiens]
                                        GCTGTAAGTCAGCTGGTGCATCTAG[A/G]ATCATTGGGATTGACCTCAACAAAG
                                        Chromosome:
                                        4:99420704
                                        Gene:
                                        ADH7 (GeneView)
                                        Functional Consequence:
                                        synonymous codon
                                        Validated:
                                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        T=0.1198/600
                                        HGVS:
                                        NC_000004.11:g.100341861C>T, NC_000004.12:g.99420704C>T, NM_000673.4:c.690G>A, NM_001166504.1:c.714G>A, NP_000664.2:p.Arg230, NP_001159976.1:p.Arg238

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center