Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs121917987 [Homo sapiens]
    CGAAGACGTGAATAATCATACTGAT[G/T]GCCTAAAACTAATAGAAAGAAATGA
    Chromosome:
    2:166002570
    Gene:
    LOC102724058 (GeneView) SCN1A (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Allele Origin:
    G(unknown)/T(germline,unknown)
    Clinical significance:
    untested
    Validated:
    no info
    HGVS:
    AB093548.1:c.4186T>G, BAC21101.1:p.Cys1396Gly, NC_000002.11:g.166859080A>C, NC_000002.12:g.166002570A>C, NG_011906.1:g.76070T>G, NM_001165963.1:c.4186T>G, NM_001165964.1:c.4102T>G, NM_001202435.1:c.4186T>G, NM_006920.4:c.4153T>G, NP_001159435.1:p.Cys1396Gly, NP_001159436.1:p.Cys1368Gly, NP_001189364.1:p.Cys1396Gly, NP_008851.3:p.Cys1385Gly, NR_110598.1:n.176-13043A>C, XM_011511602.2:c.4186T>G, XM_011511604.2:c.4153T>G, XM_011511605.2:c.4150T>G, XM_011511606.2:c.4102T>G, XM_017004644.1:c.4186T>G, XM_017004645.1:c.4153T>G, XM_017004646.1:c.4153T>G, XM_017004647.1:c.4153T>G, XM_017004648.1:c.4153T>G, XM_017004649.1:c.4153T>G, XM_017004650.1:c.4150T>G, XM_017004651.1:c.4102T>G, XM_017004652.1:c.4102T>G, XM_017004653.1:c.4099T>G, XM_017004654.1:c.1744T>G, XP_011509904.1:p.Cys1396Gly, XP_011509906.1:p.Cys1385Gly, XP_011509907.1:p.Cys1384Gly, XP_011509908.1:p.Cys1368Gly, XP_016860133.1:p.Cys1396Gly, XP_016860134.1:p.Cys1385Gly, XP_016860135.1:p.Cys1385Gly, XP_016860136.1:p.Cys1385Gly, XP_016860137.1:p.Cys1385Gly, XP_016860138.1:p.Cys1385Gly, XP_016860139.1:p.Cys1384Gly, XP_016860140.1:p.Cys1368Gly, XP_016860141.1:p.Cys1368Gly, XP_016860142.1:p.Cys1367Gly, XP_016860143.1:p.Cys582Gly, XR_001738883.1:n.4636T>G, XR_001738884.1:n.4608T>G, XR_001738885.1:n.4600T>G
    2.

    rs121917966 [Homo sapiens]
      TGCTGGGAAAACGTACATGATATTT[C/T]TTGTATTGGTCATTTTCTTGGGCTC
      Chromosome:
      2:166046940
      Gene:
      SCN1A (GeneView)
      Functional Consequence:
      missense,nc transcript variant,utr variant 5 prime
      Allele Origin:
      T(germline)/C(germline,unknown)
      Clinical significance:
      untested
      Validated:
      no info
      HGVS:
      AB093548.1:c.1207T>C, BAC21101.1:p.Phe403Leu, NC_000002.11:g.166903450A>G, NC_000002.12:g.166046940A>G, NG_011906.1:g.31700T>C, NM_001165963.1:c.1207T>C, NM_001165964.1:c.1207T>C, NM_001202435.1:c.1207T>C, NM_006920.4:c.1207T>C, NP_001159435.1:p.Phe403Leu, NP_001159436.1:p.Phe403Leu, NP_001189364.1:p.Phe403Leu, NP_008851.3:p.Phe403Leu, XM_011511602.2:c.1207T>C, XM_011511604.2:c.1207T>C, XM_011511605.2:c.1207T>C, XM_011511606.2:c.1207T>C, XM_017004644.1:c.1207T>C, XM_017004645.1:c.1207T>C, XM_017004646.1:c.1207T>C, XM_017004647.1:c.1207T>C, XM_017004648.1:c.1207T>C, XM_017004649.1:c.1207T>C, XM_017004650.1:c.1207T>C, XM_017004651.1:c.1207T>C, XM_017004652.1:c.1207T>C, XM_017004653.1:c.1207T>C, XM_017004654.1:c.-1219T>C, XP_011509904.1:p.Phe403Leu, XP_011509906.1:p.Phe403Leu, XP_011509907.1:p.Phe403Leu, XP_011509908.1:p.Phe403Leu, XP_016860133.1:p.Phe403Leu, XP_016860134.1:p.Phe403Leu, XP_016860135.1:p.Phe403Leu, XP_016860136.1:p.Phe403Leu, XP_016860137.1:p.Phe403Leu, XP_016860138.1:p.Phe403Leu, XP_016860139.1:p.Phe403Leu, XP_016860140.1:p.Phe403Leu, XP_016860141.1:p.Phe403Leu, XP_016860142.1:p.Phe403Leu, XR_001738883.1:n.1593T>C, XR_001738884.1:n.1598T>C, XR_001738885.1:n.1590T>C

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center