Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs7997013 [Homo sapiens]
    attaagaatcatggatttctcttgc[A/T]atctctaatttcatcccaacatcac
    Chromosome:
    13:109051154
    Gene:
    MYO16 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4617/2312
    HGVS:
    NC_000013.10:g.109703502T>A, NC_000013.11:g.109051154T>A, NM_001198950.1:c.2873-1146T>A, NM_015011.1:c.2807-1146T>A, XM_011521062.1:c.2807-1146T>A
    2.

    rs7997012 [Homo sapiens]
      TGCCATTATCTTCAAAGACTTAATT[A/G]ACAATATTTGTCACTTGCCTATGCA
      Chromosome:
      13:46837850
      Gene:
      HTR2A (GeneView)
      Functional Consequence:
      intron variant
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2728/1366
      HGVS:
      NC_000013.10:g.47411985A>G, NC_000013.11:g.46837850A>G, NG_013011.1:g.64185T>C, NM_000621.4:c.614-2211T>C, NM_001165947.2:c.362-2211T>C
      4.

      rs1928040 [Homo sapiens]
        CACTCATAACTGAAGATCATTTCAC[C/T]TTTGAATGAGAATTTGTCTCTGAAG
        Chromosome:
        13:46873101
        Gene:
        HTR2A (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        G=0.4495/2251
        HGVS:
        NC_000013.10:g.47447236G>A, NC_000013.11:g.46873101G>A, NG_013011.1:g.28934C>T, NM_000621.4:c.613+19289C>T, NM_001165947.2:c.361+19289C>T
        5.

        rs6316 [Homo sapiens]
          CTACCTTGCAGCTTATGACATACAC[A/G]TAGAGGGAGGTCTGATGAAATGAAC
          Chromosome:
          13:46897088
          Gene:
          HTR2A (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          C=0.0355/178
          HGVS:
          NC_000013.10:g.47471223T>C, NC_000013.11:g.46897088T>C, NG_013011.1:g.4947A>G, NM_000621.4:c.-743A>G, NM_001165947.2:c.-255A>G
          6.

          rs6313 [Homo sapiens]
            GGCTCTACAGTAATGACTTTAACTC[C/T]GGAGAAGCTAACACTTCTGATGCAT
            Chromosome:
            13:46895805
            Gene:
            HTR2A (GeneView)
            Functional Consequence:
            intron variant,synonymous codon
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            A=0.4413/2210
            HGVS:
            NC_000013.10:g.47469940G>A, NC_000013.11:g.46895805G>A, NG_013011.1:g.6230C>T, NM_000621.4:c.102C>T, NM_001165947.2:c.160+869C>T, NP_000612.1:p.Ser34
            7.

            rs6311 [Homo sapiens]
              ATGTCCTCGGAGTGCTGTGAGTGTC[C/T]GGCACTTCCATCCAAAGCCAACAGT
              Chromosome:
              13:46897343
              Gene:
              HTR2A (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.4435/2221
              HGVS:
              NC_000013.10:g.47471478C>T, NC_000013.11:g.46897343C>T, NG_013011.1:g.4692G>A, NM_000621.4:c.-998G>A, NM_001165947.2:c.-510G>A

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center