Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs605059 [Homo sapiens]
    CCGAGCTCAGGGTCCCCCACCGCAC[C/G/T]GCGCCCGGCCTCGTCCTCTGCCCCA
    Chromosome:
    17:42554888
    Gene:
    HSD17B1 (GeneView) LOC108783654 (GeneView)
    Functional Consequence:
    downstream variant 500B,missense,nc transcript variant,synonymous codon,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4774/2391
    HGVS:
    NC_000017.10:g.40706906G>A, NC_000017.10:g.40706906G>C, NC_000017.11:g.42554888G>A, NC_000017.11:g.42554888G>C, NM_000413.3:c.937G>A, NM_000413.3:c.937G>C, NM_001330219.2:c.940G>A, NM_001330219.2:c.940G>C, NP_000404.2:p.Gly313Arg, NP_000404.2:p.Gly313Ser, NP_001317148.1:p.Gly314Arg, NP_001317148.1:p.Gly314Ser, NR_144397.1:n.1219G>A, NR_144397.1:n.1219G>C, NR_144402.1:n.-86C>G, NR_144402.1:n.-86C>T, XM_005257290.1:c.1026G>A, XM_005257290.1:c.1026G>C, XM_005257291.1:c.1023G>A, XM_005257291.1:c.1023G>C, XM_005257292.1:c.1030G>A, XM_005257292.1:c.1030G>C, XM_005257292.3:c.1030G>A, XM_005257292.3:c.1030G>C, XM_005257293.1:c.940G>A, XM_005257293.1:c.940G>C, XM_005257294.1:c.*479G>A, XM_005257294.1:c.*479G>C, XM_006721857.3:c.1119G>A, XM_006721857.3:c.1119G>C, XM_006721858.3:c.1116G>A, XM_006721858.3:c.1116G>C, XM_006721859.3:c.1033G>A, XM_006721859.3:c.1033G>C, XM_011524729.1:c.1026G>A, XM_011524729.1:c.1026G>C, XM_011524730.1:c.1023G>A, XM_011524730.1:c.1023G>C, XM_011524731.1:c.940G>A, XM_011524731.1:c.940G>C, XM_011524732.2:c.*479G>A, XM_011524732.2:c.*479G>C, XP_005257347.1:p.Ala342, XP_005257348.1:p.Ala341, XP_005257349.1:p.Gly344Arg, XP_005257349.1:p.Gly344Ser, XP_005257350.1:p.Gly314Arg, XP_005257350.1:p.Gly314Ser, XP_006721920.1:p.Ala373, XP_006721921.1:p.Ala372, XP_006721922.1:p.Gly345Arg, XP_006721922.1:p.Gly345Ser, XP_011523031.1:p.Ala342, XP_011523032.1:p.Ala341, XP_011523033.1:p.Gly314Arg, XP_011523033.1:p.Gly314Ser, XR_243653.1:n.1219G>A, XR_243653.1:n.1219G>C, XR_934451.1:n.1219G>A, XR_934451.1:n.1219G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center