Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 6

1.

rs1568868 [Homo sapiens]
    AGTAGGGAAGAATTTTAGCATAAAA[G/T]GGCAAGCCTAGGCTGTGGATTTAGA
    Chromosome:
    7:70984970
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1462/732
    HGVS:
    NC_000007.13:g.70449956C>A, NC_000007.14:g.70984970C>A
    2.

    rs1525303 [Homo sapiens]
      CTTGGGAGTCACAGAATAGAATCCC[A/T]CCTTCACTGTGACCCCTGGCCAGCA
      Chromosome:
      7:70965150
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4754/2381
      HGVS:
      NC_000007.13:g.70430136T>A, NC_000007.14:g.70965150T>A
      3.

      rs1525287 [Homo sapiens]
        TCCTCTCAACTAGAGCCTTCACTCC[A/G]AAAAATGACTTTGCTTTTTGGCAAG
        Chromosome:
        7:70981283
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1328/665
        HGVS:
        NC_000007.13:g.70446269A>G, NC_000007.14:g.70981283A>G
        4.

        rs1464853 [Homo sapiens]
          AACTATTTCTGAGGTCCTATGACTT[C/T]CTCCAAGTTCTCAACGCTAACCTGA
          Chromosome:
          7:70954832
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.4561/2284
          HGVS:
          NC_000007.13:g.70419818A>G, NC_000007.14:g.70954832A>G
          5.

          rs1464851 [Homo sapiens]
            CCTTTGAGATCATTTCCCTGCTCCA[C/T]CTACAGTCAGAAAGCCATTGGGCAA
            Chromosome:
            7:70955026
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4361/2184
            HGVS:
            NC_000007.13:g.70420012G>A, NC_000007.14:g.70955026G>A
            6.

            rs152303 [Homo sapiens]
              AAAAAAAAAAAAGTACAATAATAAC[A/C]GTCAAATCTATTAAGTGTTTACCTC
              Chromosome:
              16:11214242
              Gene:
              LOC107984859 (GeneView)
              Functional Consequence:
              downstream variant 500B,intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.3614/1810
              HGVS:
              NC_000016.10:g.11214242A>C, NC_000016.9:g.11308099A>C, XM_017023924.1:c.*508A>C, XM_017023925.1:c.*508A>C, XM_017023926.1:c.*508A>C, XM_017023927.1:c.564+967A>C, XM_017023928.1:c.405+2439A>C, XR_001752080.1:n.817+967A>C

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center