Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 10

2.
3.

rs2304224 [Homo sapiens]
  • Suspected
CTCCGGCAGCACCATGTCGCTCTTG[C/G/T]TCGTCAGCATGGCGTGTGTTGGTGA
Chromosome:
19:54769863
Gene:
KIR2DL1 (GeneView) KIR2DS1 (GeneView) LOC101928804 (GeneView) LOC105379650 (GeneView)
Functional Consequence:
intron variant,missense,nc transcript variant,upstream variant 2KB
Validated:
by 1000G,by cluster,by frequency
Global MAF:
T=0.1567/785
HGVS:
CM000681.2:g.54769863G>C, CM000681.2:g.54769863G>T, NC_000019.10:g.54769863G>C, NC_000019.10:g.54769863G>T, NC_000019.9:g.55281315G>T, NG_005990.1:g.45832G>T, NG_005994.1:g.90317G>C, NG_005994.1:g.90317G>T, NG_051369.1:g.5656G>C, NG_051369.1:g.5656G>T, NM_014218.2:c.13G>C, NM_014218.2:c.13G>T, NM_014512.1:c.71-3470G>C, NM_014512.1:c.71-3470G>T, NP_055033.2:p.Val5Leu, NP_055033.2:p.Val5Phe, NR_110737.1:n.340C>A, NR_110737.1:n.340C>G, NR_110738.1:n.269C>A, NR_110738.1:n.269C>G, NT_187636.1:g.132888C>A, NT_187636.1:g.132888C>G, NT_187637.1:g.98976C>A, NT_187637.1:g.98976C>G, NT_187639.1:g.99545C>A, NT_187639.1:g.99545C>G, NT_187640.1:g.88349C>A, NT_187640.1:g.88349C>G, NT_187641.1:g.138562C>A, NT_187641.1:g.138562C>G, NT_187643.1:g.99236C>A, NT_187643.1:g.99236C>G, NT_187645.1:g.99252C>A, NT_187645.1:g.99252C>G, NT_187668.1:g.89134C>A, NT_187668.1:g.89134C>G, NT_187669.1:g.99236C>A, NT_187669.1:g.99236C>G, NT_187671.1:g.48776G>C, NT_187671.1:g.48776G>T, NT_187672.1:g.71441G>C, NT_187672.1:g.71441G>T, NT_187673.1:g.99215C>A, NT_187673.1:g.99215C>G, NT_187674.1:g.56703T, NT_187674.1:g.56703T>C, NT_187674.1:g.56703T>G, NT_187675.1:g.112862G>C, NT_187675.1:g.112862G>T, NT_187676.1:g.45777G>C, NT_187676.1:g.45777G>T, NT_187683.1:g.44040G>C, NT_187683.1:g.44040G>T, NT_187684.1:g.100728C>A, NT_187684.1:g.100728C>G, NT_187685.1:g.98728C>A, NT_187685.1:g.98728C>G, NT_187686.1:g.99584C>A, NT_187686.1:g.99584C>G, NT_187687.1:g.99037A, NT_187687.1:g.99037A>C, NT_187687.1:g.99037A>G, NT_187693.1:g.752429G>C, NT_187693.1:g.752429G>T, NW_003571054.1:g.675524T, NW_003571054.1:g.675524T>C, NW_003571054.1:g.675524T>G, NW_003571057.2:g.841976G>C, NW_003571057.2:g.841976G>T, NW_003571059.2:g.752699G>C, NW_003571059.2:g.752699G>T, NW_003571060.1:g.674197G>C, NW_003571060.1:g.674197G>T, NW_004166865.1:g.744230G>T, XP_005258946.1:p.Val5Phe, XP_005277279.1:p.Val5Phe, XP_005277310.1:p.Val5Phe, XP_005278319.1:p.Val5Phe, XP_011525241.1:p.Val5Leu, XP_011525241.1:p.Val5Phe, XP_011546300.1:p.Val5Leu, XP_011546300.1:p.Val5Phe, XP_011546672.1:p.Val5Leu, XP_011546672.1:p.Val5Phe, XP_011546673.1:p.Val5Leu, XP_011546673.1:p.Val5Phe, XP_016882272.1:p.Val5Leu, XP_016882272.1:p.Val5Phe, XP_016885773.1:p.Val5Leu, XP_016885773.1:p.Val5Phe, XP_016885775.1:p.Val5Leu, XP_016885775.1:p.Val5Phe, XP_016885782.1:p.Val5Leu, XP_016885782.1:p.Val5Phe, XR_244012.1:n.340C>A, XR_244013.1:n.269C>A, XR_254264.1:n.340A, XR_254264.1:n.340A>C, XR_254265.1:n.269A, XR_254265.1:n.269A>C, XR_254288.1:n.340C>A, XR_254289.1:n.269C>A, XR_254304.1:n.340C>A, XR_254305.1:n.269C>A, XR_254314.1:n.340C>A, XR_254315.1:n.269C>A, XR_254521.1:n.340C>A, XR_254522.1:n.269C>A
5.

rs1755038 [Homo sapiens]
    tggttttaaAAAAATTATTTCACAC[A/G]TGATtgatggcagtggctgctgcca
    Chromosome:
    6:33497642
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0785/393
    HGVS:
    CM000668.2:g.33497642G>A, NC_000006.11:g.33465419G>A
    7.
    10.

    rs1594 [Homo sapiens]
      GGGAGAGGCACTGCAGGTACAGGGA[C/T]GGTGAGCTGTGAGACTGCTCCAGCA
      Chromosome:
      2:201160898
      Gene:
      CFLAR (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3988/1997
      HGVS:
      CM000664.2:g.201160898A>G, NC_000002.11:g.202025621A>G, NC_000002.12:g.201160898A>G, NG_029005.1:g.49745A>G, NM_001127183.2:c.1260A>G, NM_001127183.3:c.1260A>G, NM_001202515.1:c.525A>G, NM_001202516.1:c.1155A>G, NM_001202516.2:c.1155A>G, NM_001202517.1:c.972A>G, NM_001202517.2:c.972A>G, NM_001202518.1:c.972A>G, NM_001202519.1:c.972A>G, NM_001202519.2:c.972A>G, NM_001308042.1:c.1260A>G, NM_001308042.2:c.1260A>G, NM_001351590.1:c.1260A>G, NM_001351593.1:c.972A>G, NM_001351594.1:c.972A>G, NM_003879.5:c.1260A>G, NM_003879.6:c.1260A>G, NP_001120655.1:p.Pro420, NP_001189444.1:p.Pro175, NP_001189445.1:p.Pro385, NP_001189446.1:p.Pro324, NP_001189447.1:p.Pro324, NP_001189448.1:p.Pro324, NP_001294971.1:p.Pro420, NP_001338519.1:p.Pro420, NP_001338522.1:p.Pro324, NP_001338523.1:p.Pro324, NP_003870.4:p.Pro420, NR_147242.1:n.1628A>G, NR_147243.1:n.1494A>G, NR_147244.1:n.1494A>G, NR_147245.1:n.1775A>G, NR_147246.1:n.1636A>G, NR_147247.1:n.1775A>G, NR_147248.1:n.1357A>G, NR_147249.1:n.1357A>G, NR_147250.1:n.1692A>G, NR_147251.1:n.1775A>G, NR_147253.1:n.1808A>G, XP_005246992.1:p.Pro420, XP_005246993.1:p.Pro420, XP_005246994.1:p.Pro420, XP_016860678.1:p.Pro420, XP_016860679.1:p.Pro420, XP_016860680.1:p.Pro420, XP_016860681.1:p.Pro420, XP_016860682.1:p.Pro420, XP_016860683.1:p.Pro420, XP_016860684.1:p.Pro324, XP_016860685.1:p.Pro175, XR_001739012.1:n.1716A>G, XR_001739013.1:n.1716A>G, XR_001739014.1:n.1716A>G, XR_001739015.1:n.3733A>G, XR_001739016.1:n.4004A>G

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center