Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 73

1.

rs5742913 [Homo sapiens]
    CAATCTGCTCATGCATTACCCACCC[A/C/G/T]CCTCGGGAGCAGGGCAGCACCCCCA
    Chromosome:
    5:134115992
    Gene:
    TCF7 (GeneView)
    Functional Consequence:
    missense,nc transcript variant,utr variant 5 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0429/215
    HGVS:
    NC_000005.10:g.134115992C>A, NC_000005.10:g.134115992C>G, NC_000005.10:g.134115992C>T, NC_000005.9:g.133451683C>A, NG_030367.1:g.6282C>A, NG_030367.1:g.6282C>G, NG_030367.1:g.6282C>T, NM_001134851.2:c.55C>A, NM_001134851.3:c.55C>A, NM_001134851.3:c.55C>G, NM_001134851.3:c.55C>T, NM_001346425.1:c.400C>A, NM_001346425.1:c.400C>G, NM_001346425.1:c.400C>T, NM_001346450.1:c.55C>A, NM_001346450.1:c.55C>G, NM_001346450.1:c.55C>T, NM_003202.3:c.400C>A, NM_003202.4:c.400C>A, NM_003202.4:c.400C>G, NM_003202.4:c.400C>T, NM_201632.3:c.55C>A, NM_201632.4:c.55C>A, NM_201632.4:c.55C>G, NM_201632.4:c.55C>T, NM_201634.3:c.55C>A, NM_201634.4:c.55C>A, NM_201634.4:c.55C>G, NM_201634.4:c.55C>T, NM_213648.3:c.55C>A, NM_213648.4:c.55C>A, NM_213648.4:c.55C>G, NM_213648.4:c.55C>T, NP_001128323.2:p.Pro19Ala, NP_001128323.2:p.Pro19Ser, NP_001128323.2:p.Pro19Thr, NP_001333354.1:p.Pro134Ala, NP_001333354.1:p.Pro134Ser, NP_001333354.1:p.Pro134Thr, NP_001333379.1:p.Pro19Ala, NP_001333379.1:p.Pro19Ser, NP_001333379.1:p.Pro19Thr, NP_003193.2:p.Pro134Ala, NP_003193.2:p.Pro134Ser, NP_003193.2:p.Pro134Thr, NP_963963.1:p.Pro19Ala, NP_963963.1:p.Pro19Ser, NP_963963.1:p.Pro19Thr, NP_963965.1:p.Pro19Ala, NP_963965.1:p.Pro19Ser, NP_963965.1:p.Pro19Thr, NP_998813.1:p.Pro19Ala, NP_998813.1:p.Pro19Ser, NP_998813.1:p.Pro19Thr, NR_033449.1:n.334C>A, NR_033449.2:n.430C>A, NR_033449.2:n.430C>G, NR_033449.2:n.430C>T, XM_006714678.3:c.400C>A, XM_006714678.3:c.400C>G, XM_006714678.3:c.400C>T, XM_006714679.3:c.400C>A, XM_006714679.3:c.400C>G, XM_006714679.3:c.400C>T, XM_006714680.3:c.400C>A, XM_006714680.3:c.400C>G, XM_006714680.3:c.400C>T, XM_006714682.2:c.400C>A, XM_006714682.2:c.400C>G, XM_006714682.2:c.400C>T, XM_006714684.2:c.400C>A, XM_006714684.2:c.400C>G, XM_006714684.2:c.400C>T, XM_006714685.3:c.55C>A, XM_006714685.3:c.55C>G, XM_006714685.3:c.55C>T, XM_006714686.3:c.55C>A, XM_006714686.3:c.55C>G, XM_006714686.3:c.55C>T, XM_011543604.2:c.400C>A, XM_011543604.2:c.400C>G, XM_011543604.2:c.400C>T, XM_011543606.1:c.400C>A, XM_011543606.1:c.400C>G, XM_011543606.1:c.400C>T, XM_011543610.2:c.-260C>A, XM_011543610.2:c.-260C>G, XM_011543610.2:c.-260C>T, XM_011543613.2:c.-260C>A, XM_011543613.2:c.-260C>G, XM_011543613.2:c.-260C>T, XM_017009789.1:c.55C>A, XM_017009789.1:c.55C>G, XM_017009789.1:c.55C>T, XP_006714741.1:p.Pro134Ala, XP_006714741.1:p.Pro134Ser, XP_006714741.1:p.Pro134Thr, XP_006714742.1:p.Pro134Ala, XP_006714742.1:p.Pro134Ser, XP_006714742.1:p.Pro134Thr, XP_006714743.1:p.Pro134Ala, XP_006714743.1:p.Pro134Ser, XP_006714743.1:p.Pro134Thr, XP_006714745.1:p.Pro134Ala, XP_006714745.1:p.Pro134Ser, XP_006714745.1:p.Pro134Thr, XP_006714747.1:p.Pro134Ala, XP_006714747.1:p.Pro134Ser, XP_006714747.1:p.Pro134Thr, XP_006714748.1:p.Pro19Ala, XP_006714748.1:p.Pro19Ser, XP_006714748.1:p.Pro19Thr, XP_006714749.1:p.Pro19Ala, XP_006714749.1:p.Pro19Ser, XP_006714749.1:p.Pro19Thr, XP_011541906.1:p.Pro134Ala, XP_011541906.1:p.Pro134Ser, XP_011541906.1:p.Pro134Thr, XP_011541908.1:p.Pro134Ala, XP_011541908.1:p.Pro134Ser, XP_011541908.1:p.Pro134Thr, XP_016865278.1:p.Pro19Ala, XP_016865278.1:p.Pro19Ser, XP_016865278.1:p.Pro19Thr, XR_001742231.1:n.604C>A, XR_001742231.1:n.604C>G, XR_001742231.1:n.604C>T, XR_001742232.1:n.604C>A, XR_001742232.1:n.604C>G, XR_001742232.1:n.604C>T, XR_948292.1:n.604C>A, XR_948292.1:n.604C>G, XR_948292.1:n.604C>T, XR_948294.2:n.604C>A, XR_948294.2:n.604C>G, XR_948294.2:n.604C>T
    2.

    rs5742909 [Homo sapiens]
      GTCTCCACTTAGTTATCCAGATCCT[C/T]AAAGTGAACATGAAGCTTCAGTTTC
      Chromosome:
      2:203867624
      Gene:
      CTLA4 (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0517/259
      HGVS:
      NC_000002.11:g.204732347C>T, NC_000002.12:g.203867624C>T, NG_011502.1:g.4839C>T, NM_001037631.2:c.-319C>T, NM_005214.4:c.-319C>T, XR_241294.1:n.-179C>T
      4.

      rs4986790 [Homo sapiens]
        GCATACTTAGACTACTACCTCGATG[A/G]TATTATTGACTTATTTAATTGTTTG
        Chromosome:
        9:117713024
        Gene:
        TLR4 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        Benign
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.0599/300
        HGVS:
        NC_000009.11:g.120475302A>G, NC_000009.12:g.117713024A>G, NG_011475.1:g.13843A>G, NM_003266.3:c.776A>G, NM_138554.3:c.896A>G, NM_138554.4:c.896A>G, NM_138557.2:c.296A>G, NP_003257.1:p.Asp259Gly, NP_612564.1:p.Asp299Gly, NP_612567.1:p.Asp99Gly, XM_005252182.1:c.890A>G, XP_005252239.1:p.Asp297Gly
        5.

        rs4795895 [Homo sapiens]
          AGGTTCTACATTAGACTAACCCACC[A/G]GGAATGGAGCAGGAAAGAACAGGGA
          Chromosome:
          17:34284427
          Gene:
          CCL11 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.0935/468
          HGVS:
          NC_000017.10:g.32611446A>G, NC_000017.11:g.34284427A>G, NG_012212.1:g.3760A>G, NM_002986.2:c.-1382A>G
          6.

          rs3775291 [Homo sapiens]
            GAGATTTTATTCTTGGTTAGGTTGA[A/C/G]TATGTGTAAGGGAGAATGAGCAAGT
            Chromosome:
            4:186082920
            Gene:
            TLR3 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.2318/1161
            HGVS:
            NC_000004.11:g.187004074C>T, NC_000004.12:g.186082920C>G, NC_000004.12:g.186082920C>T, NG_007278.1:g.18766C>G, NG_007278.1:g.18766C>T, NM_003265.2:c.1234C>G, NM_003265.2:c.1234C>T, NP_003256.1:p.Leu412Phe, NP_003256.1:p.Leu412Val, XM_017008577.1:c.403C>G, XM_017008577.1:c.403C>T, XP_016864066.1:p.Leu135Phe, XP_016864066.1:p.Leu135Val
            7.

            rs3741240 [Homo sapiens]
              CAGACTCAGAGACGGAACCAGAGAC[A/G]GGCCAGAGCATCCCCCTCCTCCACC
              Chromosome:
              11:62419070
              Gene:
              LOC102723765 (GeneView) SCGB1A1 (GeneView)
              Functional Consequence:
              intron variant,utr variant 5 prime
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.3315/1660
              HGVS:
              NC_000011.10:g.62419070G>A, NC_000011.9:g.62186542G>A, NG_021331.1:g.5036G>A, NM_003357.4:c.-26G>A, XR_001748247.1:n.348-2220C>T, XR_001748248.1:n.453-2220C>T, XR_001748249.1:n.459-2220C>T, XR_001748250.1:n.455-2220C>T, XR_001748251.1:n.460-2220C>T, XR_001748252.1:n.460-2220C>T, XR_001748253.1:n.180-2220C>T, XR_001748254.1:n.461-2220C>T
              10.

              rs2569190 [Homo sapiens]
                AATGAAGGATGTTTCAGGGAGGGGG[A/G]CCGTAACAGGAAGGATTCTGCAGGG
                Chromosome:
                5:140633331
                Gene:
                CD14 (GeneView) TMCO6 (GeneView)
                Functional Consequence:
                intron variant,utr variant 5 prime
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.4688/2348
                HGVS:
                NC_000005.10:g.140633331A>G, NC_000005.9:g.140012916A>G, NG_023178.1:g.5371T>C, NM_000591.3:c.-260T>C, NM_001040021.2:c.-121-139T>C, NM_001174104.1:c.-221-39T>C, NM_001174105.1:c.-121-139T>C, XM_011537665.2:c.-129-8334A>G
                12.

                rs2254958 [Homo sapiens]
                  TCCTAAACAATCTTCATCGAGGCAT[C/T]GAGGTCCATCCCAATAAAAATCAGG
                  Chromosome:
                  2:37149148
                  Gene:
                  EIF2AK2 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB,utr variant 5 prime
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.3732/1869
                  HGVS:
                  NC_000002.11:g.37376291G>A, NC_000002.12:g.37149148G>A, NG_030351.1:g.12900C>T, NM_001135651.2:c.-183-125C>T, NM_001135652.2:c.-1342C>T, NM_002759.3:c.-308C>T, XM_005264432.1:c.-308C>T, XM_011532987.2:c.-99-209C>T, XM_017004503.1:c.-183-125C>T
                  13.

                  rs2243639 [Homo sapiens]
                    TTCCACTGCTCACCTGCTGCCCCTG[C/T]GTTTCCAGGGACTCCACGCTCACCA
                    Chromosome:
                    10:79941966
                    Gene:
                    SFTPD (GeneView)
                    Functional Consequence:
                    missense
                    Clinical significance:
                    Benign
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2296/1150
                    HGVS:
                    NC_000010.10:g.81701722T>C, NC_000010.11:g.79941966T>C, NG_042218.1:g.12140A>G, NM_003019.4:c.538A>G, NP_003010.4:p.Thr180Ala, XM_011540087.1:c.538A>G, XM_011540088.2:c.421A>G, XP_011538389.1:p.Thr180Ala, XP_011538390.1:p.Thr141Ala
                    14.

                    rs2243250 [Homo sapiens]
                      ACACCTAAACTTGGGAGAACATTGT[C/T]CCCCAGTGCTGGGGTAGGAGAGTCT
                      Chromosome:
                      5:132673462
                      Gene:
                      IL4 (GeneView)
                      Functional Consequence:
                      upstream variant 2KB
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.4698/2353
                      HGVS:
                      NC_000005.10:g.132673462C>T, NC_000005.9:g.132009154C>T, NG_023252.1:g.4782C>T, NM_000589.3:c.-589C>T, NM_172348.2:c.-589C>T
                      17.

                      rs2230199 [Homo sapiens]
                        CAGGGAGTTCAAGTCAGAAAAGGGG[A/C/G]GCAACAAGTTCGTGACCGTGCAGGC
                        Chromosome:
                        19:6718376
                        Gene:
                        C3 (GeneView)
                        Functional Consequence:
                        missense
                        Allele Origin:
                        G(germline)/C(germline)
                        Clinical significance:
                        other
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.0873/437
                        HGVS:
                        NC_000019.10:g.6718376G>C, NC_000019.10:g.6718376G>T, NC_000019.9:g.6718387G>C, NC_000019.9:g.6718387G>T, NG_009557.1:g.7276C>A, NG_009557.1:g.7276C>G, NM_000064.2:c.304C>A, NM_000064.2:c.304C>G, NM_000064.3:c.304C>A, NM_000064.3:c.304C>G, NP_000055.2:p.Arg102Gly, NP_000055.2:p.Arg102Ser
                        18.

                        rs2228570 [Homo sapiens]
                          GGCCTGCTTGCTGTTCTTACAGGGA[A/C/G/T]GGAGGCAATGGCGGCCAGCACTTCC
                          Chromosome:
                          12:47879112
                          Gene:
                          VDR (GeneView)
                          Functional Consequence:
                          missense
                          Clinical significance:
                          Benign
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.3285/1645
                          HGVS:
                          NC_000012.11:g.48272895A>G, NC_000012.12:g.47879112A>G, NG_008731.1:g.30920T>C, NM_000376.2:c.2T>C, NM_001017535.1:c.2T>C, NM_001017536.1:c.152T>C, NP_000367.1:p.Met1Thr, NP_001017535.1:p.Met1Thr, NP_001017536.1:p.Met51Thr, XM_006719587.3:c.2T>C, XM_011538720.2:c.2T>C, XP_006719650.1:p.Met1Thr, XP_011537022.1:p.Met1Thr
                          19.

                          rs2227306 [Homo sapiens]
                            AACTCTAACTCTTTATATAGGAAGT[C/T]GTTCAATGTTGTCAGTTATGACTGT
                            Chromosome:
                            4:73741338
                            Gene:
                            CXCL8 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            T=0.2594/1299
                            HGVS:
                            NC_000004.11:g.74607055C>T, NC_000004.12:g.73741338C>T, NG_029889.1:g.5833C>T, NM_000584.3:c.65-204C>T
                            20.

                            rs2107538 [Homo sapiens]
                              TCCTGCTTATTCATTACAGATCTTA[C/T]CTCCTTTCCCTCATCCATGGAAGGA
                              Chromosome:
                              17:35880776
                              Gene:
                              CCL5 (GeneView) LOC105371744 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.3077/1541
                              HGVS:
                              NC_000017.10:g.34207780C>T, NC_000017.11:g.35880776C>T, NG_015990.1:g.4598G>A, NM_001278736.1:c.-471G>A, NM_002985.2:c.-471G>A, NT_187614.1:g.115308C>T, NW_004166864.2:g.172944C>T, XR_001752852.1:n.426+702C>T, XR_001756367.1:n.426+702C>T, XR_934696.2:n.91-3606C>T, XR_934697.2:n.91-3606C>T, XR_951963.2:n.91-3606C>T, XR_951964.2:n.91-3606C>T

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center