Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 47

2.
3.
5.

rs2383187 [Homo sapiens]
    TTGGGACTTCATTTTTCCATCACCC[A/G]GAGATCTAGGCTTTAAATCATTTGA
    Chromosome:
    9:21352980
    Validated:
    by hapmap
    HGVS:
    NC_000009.11:g.21352979A>G, NC_000009.12:g.21352980A>G
    6.

    rs2304258 [Homo sapiens]
      CTTCCGCGCCCGCGTCCAGACTCAC[C/T]CTTCCGGGGGAACACAAGCTCGAAC
      Chromosome:
      19:10380510
      Gene:
      TYK2 (GeneView)
      Functional Consequence:
      upstream variant 2KB,utr variant 5 prime
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.0066/33
      HGVS:
      NC_000019.10:g.10380510C>T, NC_000019.9:g.10491186C>T, NG_007872.1:g.5063G>A, NM_003331.4:c.-316G>A, XM_005260049.1:c.-226G>A, XM_011528245.1:c.-226G>A, XM_011528252.1:c.-916G>A, XR_001753750.1:n.-759G>A, XR_001753751.1:n.-759G>A, XR_001753752.1:n.-759G>A
      9.

      rs2280714 [Homo sapiens]
        TATCGTGGTCACATTGGTGATGCTC[A/G]GGACCTGCCAGGGTCAGAATTTATG
        Chromosome:
        7:128954671
        Gene:
        TNPO3 (GeneView)
        Functional Consequence:
        downstream variant 500B,nc transcript variant,utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        C=0.3992/1999
        HGVS:
        NC_000007.13:g.128594725C>T, NC_000007.14:g.128954671C>T, NG_023428.1:g.105503G>A, NM_001191028.2:c.*746G>A, NM_012470.3:c.*746G>A, NR_034053.2:n.4082G>A, XM_011515989.2:c.*746G>A
        10.

        rs2257167 [Homo sapiens]
          TGGTTTAAGCTTTACATATAGCTTA[C/G]TTATCTGGAAAAACTCTTCAGGTGT
          Chromosome:
          21:33343393
          Gene:
          IFNAR1 (GeneView)
          Functional Consequence:
          missense
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          C=0.2288/1146
          HGVS:
          NC_000021.8:g.34715699G>C, NC_000021.9:g.33343393G>C, NM_000629.2:c.502G>C, NP_000620.2:p.Val168Leu, XM_005260964.1:c.295G>C, XM_005260964.2:c.295G>C, XM_011529552.1:c.502G>C, XP_005261021.1:p.Val99Leu, XP_011527854.1:p.Val168Leu
          12.

          rs2073362 [Homo sapiens]
            TATCCCATGATACATTAAGTCTTTA[A/G]TAAAAATCAGAGACAATTTAAATGT
            Chromosome:
            21:33248496
            Gene:
            IFNAR2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.1046/524
            HGVS:
            NC_000021.8:g.34620801A>G, NC_000021.9:g.33248496A>G, NG_016003.1:g.23571A>G, NM_000874.4:c.395-213A>G, NM_001289125.1:c.395-213A>G, NM_001289126.1:c.395-213A>G, NM_001289128.1:c.395-213A>G, NM_207584.2:c.395-213A>G, NM_207585.2:c.395-213A>G, XM_005260965.1:c.-251-213A>G, XM_005260966.1:c.395-213A>G, XM_005260967.1:c.395-213A>G, XM_005260968.1:c.395-213A>G
            13.

            rs2066802 [Homo sapiens]
              AATTCCTGGAGCAGGTTCACCAGCT[C/T]TATGATGACAGTTTTCCCATGGAAA
              Chromosome:
              2:191009941
              Gene:
              STAT1 (GeneView)
              Functional Consequence:
              nc transcript variant,synonymous codon
              Clinical significance:
              Benign
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1146/574
              HGVS:
              NC_000002.11:g.191874667A>G, NC_000002.12:g.191009941A>G, NG_008294.1:g.9310T>C, NM_007315.3:c.63T>C, NM_139266.2:c.63T>C, NP_009330.1:p.Leu21, NP_644671.1:p.Leu21, XM_005246815.1:c.69T>C, XM_005246816.1:c.-410T>C, XM_006712718.1:c.63T>C, XM_017004783.1:c.69T>C, XP_005246872.1:p.Leu23, XP_006712781.1:p.Leu21, XP_016860272.1:p.Leu23, XR_001738914.1:n.456T>C, XR_001738915.1:n.398T>C
              14.

              rs2066798 [Homo sapiens]
                TATGGTTTCCATATACATAGAAAGA[A/G]TGTATATTCTTTTTCCCTATAGGAT
                Chromosome:
                2:191010027
                Gene:
                STAT1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.0304/152
                HGVS:
                NC_000002.11:g.191874753T>C, NC_000002.12:g.191010027T>C, NG_008294.1:g.9224A>G, NM_007315.3:c.-1-23A>G, NM_139266.2:c.-1-23A>G, XM_005246815.1:c.6-23A>G, XM_005246816.1:c.-473-23A>G, XM_006712718.1:c.-1-23A>G, XM_017004783.1:c.6-23A>G, XR_001738914.1:n.393-23A>G, XR_001738915.1:n.335-23A>G
                16.

                rs1914408 [Homo sapiens]
                  TGCTTTTCTGTCCAGGGTAAGCCAC[A/G]AGGCATTGTCATCTCAGGGTAGTGC
                  Chromosome:
                  2:190975250
                  Gene:
                  STAT1 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.1953/978
                  HGVS:
                  NC_000002.11:g.191839976C>T, NC_000002.12:g.190975250C>T, NG_008294.1:g.44001G>A, NM_007315.3:c.2136-318G>A, NM_139266.2:c.*558G>A, XM_005246815.1:c.*558G>A, XM_005246816.1:c.*558G>A, XM_006712718.1:c.2136-318G>A, XM_017004783.1:c.2142-318G>A, XR_001738914.1:n.3030+60G>A, XR_001738915.1:n.2972+60G>A
                  19.

                  rs1800593 [Homo sapiens]
                    TCAGAGACGGAACCAGAGACGGGCC[A/G]GAGCATCCCCCTCCTCCACCATGAA
                    Chromosome:
                    11:62419075
                    Gene:
                    LOC102723765 (GeneView) SCGB1A1 (GeneView)
                    Functional Consequence:
                    intron variant,utr variant 5 prime
                    Validated:
                    no info
                    HGVS:
                    NC_000011.10:g.62419075A>G, NC_000011.9:g.62186547A>G, NG_021331.1:g.5041A>G, NM_003357.4:c.-21A>G, XR_001748247.1:n.348-2225T>C, XR_001748248.1:n.453-2225T>C, XR_001748249.1:n.459-2225T>C, XR_001748250.1:n.455-2225T>C, XR_001748251.1:n.460-2225T>C, XR_001748252.1:n.460-2225T>C, XR_001748253.1:n.180-2225T>C, XR_001748254.1:n.461-2225T>C
                    20.

                    rs1547550 [Homo sapiens]
                      GGAAAAGGGGGGCTGGGGAGGGAGA[C/G]AGCAGATGGTAAGGCTTTGTGATGT
                      Chromosome:
                      2:190980999
                      Gene:
                      STAT1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.4561/2284
                      HGVS:
                      NC_000002.11:g.191845725C>G, NC_000002.12:g.190980999C>G, NG_008294.1:g.38252G>C, NM_007315.3:c.1583-330G>C, NM_139266.2:c.1583-330G>C, XM_005246815.1:c.1589-330G>C, XM_005246816.1:c.1019-330G>C, XM_006712718.1:c.1583-330G>C, XM_017004783.1:c.1589-330G>C, XR_001738914.1:n.1976-330G>C, XR_001738915.1:n.1918-330G>C

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center