Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

3.

rs1799977 [Homo sapiens]
    CTCAACCGTGGACAATATTCGCTCC[A/C/G]TCTTTGGAAATGCTGTTAGTCGGTA
    Chromosome:
    3:37012077
    Gene:
    MLH1 (GeneView)
    Functional Consequence:
    missense,utr variant 5 prime
    Allele Origin:
    G(germline)/A(germline)/C(germline)
    Clinical significance:
    Benign
    Validated:
    by 1000G,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    G=0.1296/649
    HGVS:
    NC_000003.11:g.37053568A>C, NC_000003.11:g.37053568A>G, NC_000003.12:g.37012077A>C, NC_000003.12:g.37012077A>G, NG_007109.2:g.23728A>C, NG_007109.2:g.23728A>G, NM_000249.3:c.655A>C, NM_000249.3:c.655A>G, NM_001167617.1:c.361A>C, NM_001167617.1:c.361A>G, NM_001167618.1:c.-69A>C, NM_001167618.1:c.-69A>G, NM_001167619.1:c.-69A>C, NM_001167619.1:c.-69A>G, NM_001258271.1:c.655A>C, NM_001258271.1:c.655A>G, NM_001258273.1:c.-69A>C, NM_001258273.1:c.-69A>G, NM_001258274.1:c.-69A>C, NM_001258274.1:c.-69A>G, NP_000240.1:p.Ile219Leu, NP_000240.1:p.Ile219Val, NP_001161089.1:p.Ile121Leu, NP_001161089.1:p.Ile121Val, NP_001245200.1:p.Ile219Leu, NP_001245200.1:p.Ile219Val, XM_005265161.1:c.655A>C, XM_005265161.1:c.655A>G, XM_005265162.1:c.361A>C, XM_005265162.1:c.361A>G, XM_005265163.1:c.-69A>C, XM_005265163.1:c.-69A>G, XM_005265164.1:c.-69A>C, XM_005265164.1:c.-69A>G, XM_005265165.1:c.-69A>C, XM_005265165.1:c.-69A>G, XM_005265166.1:c.-275A>C, XM_005265166.1:c.-275A>G, XM_011533727.1:c.-172A>C, XM_011533727.1:c.-172A>G, XM_017006449.1:c.-162A>C, XM_017006449.1:c.-162A>G, XM_017006450.1:c.-162A>C, XM_017006450.1:c.-162A>G, XM_017006451.1:c.-172A>C, XM_017006451.1:c.-172A>G, XP_005265218.1:p.Ile219Leu, XP_005265218.1:p.Ile219Val, XP_005265219.1:p.Ile121Leu, XP_005265219.1:p.Ile121Val

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center