Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

2.

rs80338682 [Homo sapiens]
    AGCCCGCACGTGCAGATCCCCCCCC[-/C/G]ACGTGCTCTCCTCAGGTGCGTGCCC
    Chromosome:
    17:17216394
    Gene:
    FLCN (GeneView)
    Functional Consequence:
    frameshift variant,intron variant
    Allele Origin:
    C(germline)/+.-----(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000017.10:g.17119708_17119709insG, NC_000017.10:g.17119709dupG, NC_000017.11:g.17216394_17216395insC, NC_000017.11:g.17216394_17216395insG, NC_000017.11:g.17216395dupG, NG_008001.2:g.25794_25795insC, NG_008001.2:g.25794_25795insG, NG_008001.2:g.25794dupC, NM_144997.5:c.1285_1286insC, NM_144997.5:c.1285_1286insG, NM_144997.5:c.1285dupC, NP_659434.2:p.His429Argfs, NP_659434.2:p.His429Profs, XM_005256514.1:c.1285_1286insC, XM_005256514.1:c.1285dupC, XM_005256515.1:c.1285_1286insC, XM_005256515.1:c.1285dupC, XM_005256516.1:c.1285_1286insC, XM_005256516.1:c.1285dupC, XM_011523714.2:c.1339_1340insC, XM_011523714.2:c.1339_1340insG, XM_011523714.2:c.1339dupC, XM_011523716.1:c.1339_1340insC, XM_011523716.1:c.1339_1340insG, XM_011523716.1:c.1339dupC, XM_011523718.2:c.1339_1340insC, XM_011523718.2:c.1339_1340insG, XM_011523718.2:c.1339dupC, XM_011523719.2:c.1339_1340insC, XM_011523719.2:c.1339_1340insG, XM_011523719.2:c.1339dupC, XM_011523721.2:c.1339_1340insC, XM_011523721.2:c.1339_1340insG, XM_011523721.2:c.1339dupC, XM_017024304.1:c.1339_1340insC, XM_017024304.1:c.1339_1340insG, XM_017024304.1:c.1339dupC, XM_017024305.1:c.1339_1340insC, XM_017024305.1:c.1339_1340insG, XM_017024305.1:c.1339dupC, XM_017024306.1:c.1285_1286insC, XM_017024306.1:c.1285_1286insG, XM_017024306.1:c.1285dupC, XM_017024307.1:c.1285_1286insC, XM_017024307.1:c.1285_1286insG, XM_017024307.1:c.1285dupC, XM_017024308.1:c.1285_1286insC, XM_017024308.1:c.1285_1286insG, XM_017024308.1:c.1285dupC, XM_017024309.1:c.1063_1064insC, XM_017024309.1:c.1063_1064insG, XM_017024309.1:c.1063dupC, XP_005256571.1:p.His429Profs, XP_005256572.1:p.His429Profs, XP_005256573.1:p.His429Profs, XP_011522016.1:p.His447Argfs, XP_011522016.1:p.His447Profs, XP_011522018.1:p.His447Argfs, XP_011522018.1:p.His447Profs, XP_011522020.1:p.His447Argfs, XP_011522020.1:p.His447Profs, XP_011522021.1:p.His447Argfs, XP_011522021.1:p.His447Profs, XP_011522023.1:p.His447Argfs, XP_011522023.1:p.His447Profs, XP_016879793.1:p.His447Argfs, XP_016879793.1:p.His447Profs, XP_016879794.1:p.His447Argfs, XP_016879794.1:p.His447Profs, XP_016879795.1:p.His429Argfs, XP_016879795.1:p.His429Profs, XP_016879796.1:p.His429Argfs, XP_016879796.1:p.His429Profs, XP_016879797.1:p.His429Argfs, XP_016879797.1:p.His429Profs, XP_016879798.1:p.His355Argfs, XP_016879798.1:p.His355Profs, XR_001752445.1:n.1731+674_1731+675insC, XR_001752445.1:n.1731+674_1731+675insG, XR_001752445.1:n.1731+674dupC, XR_243549.1:n.2324+674_2324+675insC, XR_243549.1:n.2324+674dupC, XR_243599.1:n.640-1095dupG, XR_243599.1:n.640-1096_640-1095insG

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center