Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs377767431 [Homo sapiens]
    GTTTATGAAGAGGATTCCTACGTGA[A/T]GAGGAGCCAGGTGCCCAGTCCCGGG
    Chromosome:
    10:43120193
    Gene:
    RET (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(unknown)/A(germline,unknown)
    Clinical significance:
    Uncertain significance
    Validated:
    no info
    HGVS:
    NC_000010.10:g.43615641A>T, NC_000010.11:g.43120193A>T, NG_007489.1:g.48125A>T, NM_020630.4:c.2720A>T, NM_020975.4:c.2720A>T, NP_065681.1:p.Lys907Met, NP_066124.1:p.Lys907Met

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center