Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs80356523 [Homo sapiens]
    AGCCTGACCCCTCTCTTCCCCCGCA[C/G]TGTATCACTGGGTGGAGATGCGGAC
    Chromosome:
    19:45553912
    Gene:
    OPA3 (GeneView)
    Functional Consequence:
    intron variant,splice acceptor variant
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000019.10:g.45553912C>G, NC_000019.9:g.46057170C>G, NG_013332.1:g.35953G>C, NM_001017989.2:c.143-24456G>C, NM_025136.2:c.143-1G>C, NM_025136.3:c.143-1G>C, XM_005259278.1:c.-17-1G>C, XM_006723403.3:c.-17-1G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center