Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs80356586 [Homo sapiens]
    GACGTGGCCATCGGCACCCACTTCA[C/T]TGACCTGCGCAAGATTTCTAATGAC
    Chromosome:
    2:26482441
    Gene:
    OTOF (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000002.11:g.26705309A>G, NC_000002.12:g.26482441A>G, NG_009937.1:g.81258T>C, NM_001287489.1:c.1544T>C, NM_194248.2:c.1544T>C, NP_001274418.1:p.Ile515Thr, NP_919224.1:p.Ile515Thr, XM_005264644.1:c.1589T>C, XM_017005338.1:c.1544T>C, XP_005264701.1:p.Ile530Thr, XP_016860827.1:p.Ile515Thr

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center