Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs138659167 [Homo sapiens]
    CGGGGTGGTACACCAAGTACAGACC[A/C/G]TGGGGGGCGAGGGGGAAGGGGTCAA
    Chromosome:
    11:71435840
    Gene:
    DHCR7 (GeneView)
    Functional Consequence:
    missense,splice acceptor variant
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0026/13
    HGVS:
    NC_000011.10:g.71435840C>A, NC_000011.10:g.71435840C>G, NC_000011.9:g.71146886C>G, NG_012655.2:g.17592G>C, NG_012655.2:g.17592G>T, NM_001163817.1:c.964-1G>C, NM_001163817.1:c.964-1G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.964-1G>T, XM_011544777.1:c.1097G>C, XM_011544777.1:c.1097G>T, XP_011543079.1:p.Arg366Met, XP_011543079.1:p.Arg366Thr
    2.

    rs104886041 [Homo sapiens]
      CCTATAACGAGGAAAGCCGCCCAGC[C/T]CTATACCTTGTGGGTCACCTTCCAG
      Chromosome:
      11:71444018
      Gene:
      DHCR7 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/C(germline)
      Validated:
      by cluster
      HGVS:
      NC_000011.10:g.71444018A>G, NC_000011.9:g.71155064A>G, NG_012655.2:g.9414T>C, NM_001163817.1:c.296T>C, NM_001360.2:c.296T>C, NP_001157289.1:p.Leu99Pro, NP_001351.2:p.Leu99Pro, XM_011544777.1:c.296T>C, XP_011543079.1:p.Leu99Pro
      3.

      rs104886035 [Homo sapiens]
        CGTCATCTTCCTACTGCTGTTCGCC[C/T]CCTTCATCGTCTACTACTTCATCAT
        Chromosome:
        11:71444163
        Gene:
        DHCR7 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        no info
        HGVS:
        NC_000011.10:g.71444163G>A, NC_000011.9:g.71155209G>A, NG_012655.2:g.9269C>T, NM_001163817.1:c.151C>T, NM_001360.2:c.151C>T, NP_001157289.1:p.Pro51Ser, NP_001351.2:p.Pro51Ser, XM_011544777.1:c.151C>T, XP_011543079.1:p.Pro51Ser
        4.

        rs80338862 [Homo sapiens]
          CGTGGCCCGCCACTTCAACTACGTC[A/G]GCGACCTGATGGGCAGCCTGGCCTA
          Chromosome:
          11:71435575
          Gene:
          DHCR7 (GeneView)
          Functional Consequence:
          missense,synonymous codon
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster,by frequency
          HGVS:
          NC_000011.10:g.71435575C>T, NC_000011.9:g.71146621C>T, NG_012655.2:g.17857G>A, NM_001163817.1:c.1228G>A, NM_001360.2:c.1228G>A, NP_001157289.1:p.Gly410Ser, NP_001351.2:p.Gly410Ser, XM_011544777.1:c.1362G>A, XP_011543079.1:p.Ser454
          5.

          rs80338859 [Homo sapiens]
            CCTCGCCCCCCAGGGTCTGTACTTG[G/T]TGTACCACCCCGTGCAGCTGTCCAC
            Chromosome:
            11:71435827
            Gene:
            DHCR7 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            G(germline)/T(germline)
            Clinical significance:
            Pathogenic
            Validated:
            by cluster,by frequency
            HGVS:
            NC_000011.10:g.71435827C>A, NC_000011.9:g.71146873C>A, NG_012655.2:g.17605G>T, NM_001163817.1:c.976G>T, NM_001360.2:c.976G>T, NP_001157289.1:p.Val326Leu, NP_001351.2:p.Val326Leu, XM_011544777.1:c.1110G>T, XP_011543079.1:p.Trp370Cys
            6.

            rs80338853 [Homo sapiens]
              ATCTGGGCCAAGACTCCACCTATAA[C/T]GAGGAAAGCCGCCCAGCTCTATACC
              Chromosome:
              11:71444036
              Gene:
              DHCR7 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              Pathogenic
              Validated:
              by cluster,by frequency
              HGVS:
              NC_000011.10:g.71444036G>A, NC_000011.9:g.71155082G>A, NG_012655.2:g.9396C>T, NM_001163817.1:c.278C>T, NM_001360.2:c.278C>T, NP_001157289.1:p.Thr93Met, NP_001351.2:p.Thr93Met, XM_011544777.1:c.278C>T, XP_011543079.1:p.Thr93Met

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center