Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs41298133 [Homo sapiens]
    CGCCATCGAGGGCGCGAAGATTGAG[C/T]AGTACCTGCTGGAAAAGTCACGTGT
    Chromosome:
    11:77156969
    Gene:
    MYO7A (GeneView)
    Functional Consequence:
    nc transcript variant,stop gained
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0002/1
    HGVS:
    NC_000011.10:g.77156969C>T, NC_000011.9:g.76868015C>T, NG_009086.1:g.33706C>T, NM_000260.3:c.700C>T, NM_001127179.2:c.700C>T, NM_001127180.1:c.700C>T, NP_000251.3:p.Gln234Ter, NP_001120651.2:p.Gln234Ter, NP_001120652.1:p.Gln234Ter, NW_003871081.1:g.158605C>T, XM_005274011.1:c.700C>T, XM_005274012.1:c.700C>T, XM_011545044.2:c.700C>T, XM_011545046.2:c.790C>T, XM_011545050.2:c.442C>T, XM_017017778.1:c.790C>T, XM_017017779.1:c.790C>T, XM_017017780.1:c.790C>T, XM_017017781.1:c.790C>T, XM_017017782.1:c.790C>T, XM_017017783.1:c.790C>T, XM_017017784.1:c.790C>T, XM_017017785.1:c.790C>T, XM_017017786.1:c.790C>T, XM_017017787.1:c.790C>T, XM_017017788.1:c.790C>T, XP_005274068.1:p.Gln234Ter, XP_005274069.1:p.Gln234Ter, XP_011543346.1:p.Gln234Ter, XP_011543348.2:p.Gln264Ter, XP_011543352.1:p.Gln148Ter, XP_016873267.1:p.Gln264Ter, XP_016873268.1:p.Gln264Ter, XP_016873269.1:p.Gln264Ter, XP_016873270.1:p.Gln264Ter, XP_016873271.1:p.Gln264Ter, XP_016873272.1:p.Gln264Ter, XP_016873273.1:p.Gln264Ter, XP_016873274.1:p.Gln264Ter, XP_016873275.1:p.Gln264Ter, XP_016873276.1:p.Gln264Ter, XP_016873277.1:p.Gln264Ter, XR_001747885.1:n.805C>T, XR_001747886.1:n.805C>T, XR_001747887.1:n.805C>T, XR_001747888.1:n.805C>T, XR_001747889.1:n.805C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center