Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs1800795 [Homo sapiens]
    ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA
    Chromosome:
    7:22727026
    Gene:
    IL6 (GeneView) LOC541472 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.1412/707
    HGVS:
    NC_000007.13:g.22766645C>G, NC_000007.14:g.22727026C>G, NG_011640.1:g.4880C>G, NM_000600.4:c.-237C>G, NM_001318095.1:c.-274C>G, NR_131935.1:n.54-321G>C, XM_005249745.1:c.-237C>G, XM_005249745.4:c.-237C>G, XM_005249746.1:c.-274C>G, XM_011515390.2:c.-84-153C>G
    3.

    rs16944 [Homo sapiens]
      TACCTTGGGTGCTGTTCTCTGCCTC[A/G]GGAGCTCTCTGTCAATTGCAGGAGC
      Chromosome:
      2:112837290
      Gene:
      IL1B (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4906/2457
      HGVS:
      NC_000002.11:g.113594867A>G, NC_000002.12:g.112837290A>G, NG_008851.1:g.4490T>C, NM_000576.2:c.-598T>C, XM_017003988.1:c.-629T>C

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center