Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs10163409 [Homo sapiens]
    CACATAAGAAGAGGGATACTGAGGC[A/T]TAATTATACATTTATATGGTAGTTT
    Chromosome:
    16:54104968
    Gene:
    FTO (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1446/724
    HGVS:
    NC_000016.10:g.54104968A>T, NC_000016.9:g.54138880A>T, NG_012969.1:g.406006A>T, NM_001080432.2:c.1365-6794A>T, XM_011523313.2:c.1395-6794A>T
    2.

    rs1440620 [Homo sapiens]
      AAGTGAGGTCTTTTTTATCAGTGGT[A/G]TCTAATCACAGGTACAATGTCATTA
      Chromosome:
      1:214088007
      Gene:
      LOC105372911 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2732/1368
      HGVS:
      NC_000001.10:g.214261350T>C, NC_000001.11:g.214088007T>C, XR_922584.2:n.261-15569A>G
      3.

      rs838133 [Homo sapiens]
        GACCAGCCAGCACAGAAACCCACAG[C/T]CCTGAGTGCTCGAACCCGGTCTCGT
        Chromosome:
        19:48756272
        Gene:
        FGF21 (GeneView) FUT1 (GeneView)
        Functional Consequence:
        synonymous codon,upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.2282/1143
        HGVS:
        NC_000019.10:g.48756272A>G, NC_000019.9:g.49259529A>G, NG_007510.2:g.4119T>C, NG_033945.1:g.5186A>G, NM_000148.3:c.-1857T>C, NM_019113.3:c.36A>G, NP_061986.1:p.Gly12, XM_005258712.1:c.-1488T>C, XM_005258731.1:c.36A>G, XP_005258788.1:p.Gly12
        4.

        rs197273 [Homo sapiens]
          GATAACAGAAGAAAGGGAAACTCTC[A/G]TTTTTTGTTTAGATGTTATTAATGT
          Chromosome:
          2:161038152
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.4044/2025
          HGVS:
          NC_000002.11:g.161894663A>G, NC_000002.12:g.161038152A>G

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center