Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs12979860 [Homo sapiens]
    TGAACCAGGGAGCTCCCCGAAGGCG[C/T]GAACCAGGGTTGAATTGCACTCCGC
    Chromosome:
    19:39248147
    Gene:
    IFNL4 (GeneView)
    Functional Consequence:
    intron variant
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3558/1782
    HGVS:
    NC_000019.10:g.39248147C>T, NC_000019.9:g.39738787C>T, NG_042193.1:g.1825G>A, NM_001276254.2:c.151-152G>A, NR_074079.1:n.429-152G>A
    2.

    rs8099917 [Homo sapiens]
      TTTTGTTTTCCTTTCTGTGAGCAAT[G/T]TCACCCAAATTGGAACCATGCTGTA
      Chromosome:
      19:39252525
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1312/657
      HGVS:
      NC_000019.10:g.39252525T>G, NC_000019.9:g.39743165T>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center