Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs17300539 [Homo sapiens]
    TCAGAATGTGTGGCTTGCAAGAACC[A/G]GCTCAGATCCTGCCCTTCAAAAACA
    Chromosome:
    3:186841671
    Gene:
    ADIPOQ (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0268/134
    HGVS:
    NC_000003.11:g.186559460G>A, NC_000003.12:g.186841671G>A, NG_021140.1:g.3998G>A, NM_001177800.1:c.-1138G>A, NM_004797.3:c.-1087G>A
    2.

    rs822387 [Homo sapiens]
      agttttgagatttctttatacaatc[C/T]agatccaaatctcttgtctcaaata
      Chromosome:
      3:186838248
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1334/668
      HGVS:
      NC_000003.11:g.186556037T>C, NC_000003.12:g.186838248T>C, NG_021140.1:g.575T>C

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center