Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs4784227 [Homo sapiens]
    AAAAGTCCCAATTTGTAGTGTTTGC[C/T]GATTATTGTGATGTAAATACTCCCA
    Chromosome:
    16:52565276
    Gene:
    CASC16 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2001/1002
    HGVS:
    NC_000016.10:g.52565276C>T, NC_000016.9:g.52599188C>T, NR_033920.1:n.605-2414G>A, XR_243421.1:n.38-2414G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center