Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs17530068 [Homo sapiens]
    TATAACCAGTGTGGAAAGTTAACTC[C/T]ATGGGGCTAAACAAATTCTCTTAAC
    Chromosome:
    6:81483392
    Gene:
    LOC105377871 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1755/879
    HGVS:
    NC_000006.11:g.82193109T>C, NC_000006.12:g.81483392T>C, XR_001744218.1:n.1402+8099A>G
    2.

    rs2284378 [Homo sapiens]
      GGTCAGTGTGTGGGCTGGACTAAGG[C/T]CCTTTCTTTTTATAGCCCTGTTTCC
      Chromosome:
      20:34000289
      Gene:
      RALY (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2035/1019
      HGVS:
      NC_000020.10:g.32588095T>C, NC_000020.11:g.34000289T>C, NM_007367.3:c.-93+6158T>C, NM_016732.2:c.-93+6158T>C, XM_005260334.1:c.-10+6158T>C, XM_005260334.4:c.-10+6158T>C, XM_005260335.1:c.-210+6158T>C, XM_005260336.1:c.-10+6158T>C, XM_005260336.4:c.-10+6158T>C, XM_011528695.2:c.-210+6158T>C, XM_017027731.1:c.-10+6158T>C

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center