Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs55705857 [Homo sapiens]
    GGACTTGCTCAGAAGCCGTTCTGCA[A/G]ATGCATTTCTTGAACAAAGGGCCAA
    Chromosome:
    8:129633446
    Gene:
    CCDC26 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0182/91
    HGVS:
    NC_000008.10:g.130645692A>G, NC_000008.11:g.129633446A>G, NR_130917.1:n.312+46482T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center