Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs6968865 [Homo sapiens]
    gattgcttgcttgttggttgggaga[A/T]atctccacacattgggtaaaagaag
    Chromosome:
    7:17247645
    Gene:
    LOC101927609 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4567/2287
    HGVS:
    CM000669.2:g.17247645A>T, NC_000007.13:g.17287269A>T, NC_000007.14:g.17247645A>T, XR_927073.2:n.861+11607T>A
    2.

    rs4410790 [Homo sapiens]
      AAATGTTTTCCTTATTTTATTACAT[C/T]AGCAGGGACCTTGAGTTAAAAGTTA
      Chromosome:
      7:17244953
      Gene:
      LOC101927609 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4671/2339
      HGVS:
      CM000669.2:g.17244953T>C, NC_000007.13:g.17284577T>C, NC_000007.14:g.17244953T>C, XR_927073.2:n.861+14299A>G
      3.

      rs2472297 [Homo sapiens]
        ACACTCTGTTTCCAAGTTAGTAATG[C/T]CTCTTTACATATAAACACTGATGTT
        Chromosome:
        15:74735539
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.0657/329
        HGVS:
        CM000677.2:g.74735539C>T, NC_000015.10:g.74735539C>T, NC_000015.9:g.75027880C>T, NG_008431.2:g.17998C>T
        4.

        rs2470893 [Homo sapiens]
          GTTCCCTTCTCTGTCAATCGCCAGC[A/G]CCTCCGAACAGCTCCTGGCACATAG
          Chromosome:
          15:74727108
          Gene:
          CYP1A1 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.0905/453
          HGVS:
          CM000677.2:g.74727108C>T, NC_000015.10:g.74727108C>T, NC_000015.9:g.75019449C>T, NG_008431.2:g.9567C>T, NG_055242.1:g.3414C>T, NM_000499.4:c.-1694G>A, NM_001319216.1:c.-1697G>A, NM_001319217.1:c.-1697G>A

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center