Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs3814290 [Homo sapiens]
    GAAGGTGCCCGAGATGGCTGTGCCC[A/G]ATGTGCACCTCCCGGAAGTGCAGCT
    Chromosome:
    19:40396401
    Gene:
    PRX (GeneView)
    Functional Consequence:
    missense,utr variant 3 prime
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0002/1
    HGVS:
    NC_000019.10:g.40396401C>T, NC_000019.9:g.40902308C>T, NG_007979.1:g.21964G>A, NM_020956.2:c.*2156G>A, NM_181882.2:c.1951G>A, NP_870998.2:p.Asp651Asn, XM_005259111.1:c.1873G>A, XM_011527171.2:c.1951G>A, XM_017027046.1:c.1849G>A, XM_017027047.1:c.1849G>A, XP_005259168.1:p.Asp625Asn, XP_011525473.1:p.Asp651Asn, XP_016882535.1:p.Asp617Asn, XP_016882536.1:p.Asp617Asn

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center