Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs55762744 [Homo sapiens]
    GCAATGTGGATGCAGACTTCCTCAG[C/T]TGTCAGCGATGACTCACTGAAAGTG
    Chromosome:
    19:10378250
    Gene:
    TYK2 (GeneView)
    Functional Consequence:
    missense,nc transcript variant,utr variant 5 prime
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0038/19
    HGVS:
    NC_000019.10:g.10378250C>T, NC_000019.9:g.10488926C>T, NG_007872.1:g.7323G>A, NM_003331.4:c.157G>A, NP_003322.3:p.Ala53Thr, XM_005260049.1:c.157G>A, XM_011528245.1:c.157G>A, XM_011528246.2:c.-373G>A, XM_011528252.1:c.157G>A, XP_005260106.1:p.Ala53Thr, XP_011526547.1:p.Ala53Thr, XP_011526554.1:p.Ala53Thr, XR_001753750.1:n.314G>A, XR_001753751.1:n.314G>A, XR_001753752.1:n.314G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center