Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs386134157 [Homo sapiens]
    CCTGTTTTGCAGAAAGGGGGCCCTG[A/G]GGCAGAAGGTGGTCCACGAAGTCAA
    Chromosome:
    19:53882570
    Gene:
    PRKCG (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(unknown)/A(germline,unknown)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000019.10:g.53882570A>G, NC_000019.9:g.54385824A>G, NG_009114.1:g.5358A>G, NM_001316329.1:c.76A>G, NM_002739.3:c.76A>G, NM_002739.4:c.76A>G, NP_001303258.1:p.Arg26Gly, NP_002730.1:p.Arg26Gly, XM_005259054.1:c.76A>G, XP_005259111.1:p.Arg26Gly

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center